Query (optional)   in Class  

GrainGenes Sequence Report: CDO1015_WHE05E08.s1

[ Printable Version ]  [ Submit comment/correction ]

Sequence
CDO1015_WHE05E08.s1
Probe
CDO1015
DNA Homology
PMU19361148noncereal_BlastN
[ Show all 186 ]
DNA
tcattcacaagctagagctttgagctatgttacaaaaagaataagagatc
gttcgtggtacaacaatatctgtgaatataatgaacaaatggggaggatc
atacacacactacacaaaaatcaaaatatcagttaaaaatgattcaaaag
tggttgggagaaaacagatacaaaattatacaggcagagcgcgaaccagg
cctcactgcgctttcatggctttttccttgcagagctggtgccactcctg
gagcacggccgcctggagagcgcggtgctcggcttcctcggccgtgacct
ttgagagagtcgatgggcccttggggattcccaaatccgtccaactcctc
actctgcttcttctcctcttcttcttcttgctcggttttcgcagtgggca
ccttaggtttgggctgcctgagtaggggctaacctctcccagggatatct
tcagccgctcgggggnggcan
BLAST
BLAST Search