Query (optional)   in Class  

GrainGenes Sequence Report: CDO1090_WHE05F10.s1

[ Printable Version ]  [ Submit comment/correction ]

Sequence
CDO1090_WHE05F10.s1
Probe
CDO1090
DNA Homology
OSHSP82G201rice_BlastN
[ Show all 272 ]
DNA
gctaaacatatagaagtaacaataacaacgaactgttccacaaagcacag
aaaatatagctaaccacgcttactgtttggccagccaagagacaaaaccg
atacatctaaacgtgccaaaacaatccaacagcagtcagaatgacaccta
aagtaaactaggcggtggtggtgcaggtgcatacgaagactgccatggcg
cttagtcgacctcctccatcttgctctcaccggcatcatcctccnngggt
gggcatgtcggtgtcgtcagccgtggcctcctcatcctcatcaatgctca
ggccaagcttgagcatgcggtgggatcctggtgccgaagtgttggggtcc
tccaggctgaagccagagtgagcaggaggtctcgaagnacagcatcacga
ggtcctgacagacttgtcgttcttgtcagcatcggcacgcttgnggagtc
gttccn
BLAST
BLAST Search