Query (optional)   in Class  

GrainGenes Sequence Report: CDO1312_WHE05E12.s1

[Submit comment/correction]

Sequence
CDO1312_WHE05E12.s1
Probe
CDO1312
DNA Homology
CELM60121noncereal_BlastN
SBPPSTK2120grass_BlastN
C22466101rice_EST
C22466278rice_EST
DNA
tgatcttttatatccttgtacgaatccttccaatacaaaaataacggcac
acagccctggngccaaccaaaagtattcaggatgcctgttagacatccac
attgcgatacaaggagcatctccgggagggcctcttcatacatttacttt
ttgtacaattgcgctcgataaaaaagaagggcgctgtctttgagtatacn
agagatggactgtcgatttggtgccagaaaaaatattcaaatacccaagc
ggtatcgtctggaagacatggtccattgatatggcaccaganagacagat
ccagttccatgccatcatcgcgactgttttgtagttgcgtcagattcaga
tttccacactatgtctttcagttctgttgagaaactcttgtagaaactgt
gggaactcccaaggtgtcccctccagttttggcganttccaaccatatgt
agcgatg

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.