Query (optional)   in Class  

GrainGenes Sequence Report: CDO1373_WHE03C12.r1

[ Printable Version ]  [ Submit comment/correction ]

Sequence
CDO1373_WHE03C12.r1
Probe
CDO1373
DNA Homology
OSHSC70A1170rice_BlastN
[ Show all 494 ]
DNA
gcttcttcaggacttcttcaatggcaaggagctctgcaagacattcaacc
ctgatgaggctgttgcctacggagctgctgtccaggctgccatcttgagc
ggagagggcaacgagaaggttcaggacctgttgctgctggatgtcacccc
cctctctcttggtctggagacagctggaggtgtgatgacagtcttgattc
caaggaacaccaccatcccaaccaagaaggagcaggtgttctccacttac
tcggacaaccagcctggngtgcttatccaggtgtacgagggtgatnggac
cangaccncgtgacaacaacctccttggncaagtttgagnnnctnngggc
atccttnctggcccccagaggggtnntnncagantgnntggtcntggtgt
tgnnattggatngnnatcggnnattcnntannngggtttngctgttgtcn
ngnagnnttggnnggnngtgtnangntntgtngtnntgaantgntngggg
gangagnngtnggntn
BLAST
BLAST Search