Query (optional)   in Class  

GrainGenes Sequence Report: CDO1385_WHE05F02.s1

[ Printable Version ]  [ Submit comment/correction ]

Sequence
CDO1385_WHE05F02.s1
Probe
CDO1385
DNA Homology
CEY57G11A129noncereal_BlastN
HSPKM12123noncereal_BlastN
AA278059120noncereal_EST
AA245754120noncereal_EST
DNA
tattataaagtagcacaaacgatcaactggccaaatctatnnttaacaaa
catgcagaggtagggaaggaaccataaagacggttacaaattattacaat
cgcgcatagtgtcttctgaacttgttcttaagttttgattcttacagaac
caaataaataagcagcaacgctggnacatgctttcactaaagcagtttta
ttccgtccacccctcaagctttttggagaagctggatgtgaaaaccatct
ggaaatcgcaatccaggagaaagcaccatgctgcctcccttgatagtttt
ccacctgcagtatgcataaagtttcagtatatgcctgatactatagnatg
naacngttttaggngncnccngtncnagaggggacccgcntttagnaacn
nagcnngggggggnaantggnanttgnngnnnngnnnnaannaggggnng
ncccnaaan
BLAST
BLAST Search