Query (optional)   in Class  

GrainGenes Sequence Report: CDO1428_WHE03E05.r1

[ Submit comment/correction ]

Sequence
CDO1428_WHE03E05.r1
Probe
CDO1428
DNA Homology
BLYGAPDH1044barley_BlastN
[ Show all 763 ]
DNA
gtggtgccaagaaggtcatcatttctgctcccagcaaggacgctcccatg
ttcgtcatgggtgtcaacgggaaggagtacnnctctgacatcactattgt
ctccaacgctagctgcaccactaactgccttgctccccttgctaaggtta
tcaatgacaagtttggcattgttgagggtttgatgaccactgttcacgcc
atgactgcaacccagaagactgttgatggtccctcaagcaaggactggaa
gaggtggaagggctgctagctttcaaacatcattcccagcagcactggag
ctgcaaaggctgttggcaagggtgctccctggtcctcaacggaaagttga
caggaatggccttccgtgttcccaactgttgatgttttctggttgttgac
cttgaccgttagacttgagaaggcagccacctatgaagcagatcaaggct
gcaatnaagggaggaatccgaagggtaaagctcaagggg
BLAST
BLAST Search

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.