Query (optional)   in Class  

GrainGenes Sequence Report: CDO1461_WHE05H04.s1

[ Submit comment/correction ]

Sequence
CDO1461_WHE05H04.s1
Probe
CDO1461
DNA Homology
OSR22CDNA312rice_BlastN
[ Show all 253 ]
DNA
tgtcattgaagacgatgttcaggcaacttaacaatagaaccacaggcact
ttgaagctaagttccacaaaactaaaatatggtttggtaagacagataga
aatctgctgctggattatgcgacgatgtcgtccgacaggaaagcttgtcc
aggctgacggttggagaggcgaccatggcatcccagcagcttggcattga
caccatcaggcaagatcctgccctcgctcttgagcttaaggtagtcgtcc
ggttgaacttggtgaagccccacttcctgctctcaataaacntttggcga
ccagggganttgaacttagcacgacggaagagcctccggttgccagggan
gggcattgtttgggcnttcagcgccccggaccngaagggacctggggcca
ntaggccaaaacggggnacaggnancccggggggnttcccaaaaggnacc
ccnncntttccgggnttn
BLAST
BLAST Search

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.