Query (optional)   in Class  

GrainGenes Sequence Report: CDO1509_WHE05H08.s1

[ Printable Version ]  [ Submit comment/correction ]

Sequence
CDO1509_WHE05H08.s1
Probe
CDO1509
DNA Homology
RICYK34213rice_BlastN
[ Show all 495 ]
DNA
agcagtttcaaggaaactctgcataaacatctctgctacatccaacagaa
caaacacgatacgatatttaaggtatctgagacacgacatttagatatag
cacataaaacagttctgaacttgtgatgctccaaattaggctaaccctcc
atagtagaaccagaatgctaagcttcacatcgaacctttcacttcttgga
tttctttggtgccgctgctgccggagctggagctgcagctgctggtgctg
gtgcatgatccttagggccctgagcaaaccgctcctccctcctgggcatt
cttcctctctcgggcttggccttgctcttggcacgcttgggcctccaaac
tggatcagcaatgggtcttctctcttggccttttcagcccttgggactgt
gggatactctccataagaactctctgntctggaacatgttaccctggacc
tcaagtacagtcgtggnacagt
BLAST
BLAST Search