Query (optional)   in Class  

GrainGenes Sequence Report: CDO187_WHE04G08.s1

[ Submit comment/correction ]

Sequence
CDO187_WHE04G08.s1
Probe
CDO187
DNA Homology
SCFSCPEPCD376noncereal_BlastN
[ Show all 48 ]
DNA
ccaccttttaccgaaatcatctactgtaggacaaaacatggcgaatcatc
aatacgagataagagtcctgtgtgtctatccaagaaaagaaaagaaaaga
aaagaaaaatcaagaatcagccggtgttctgcatgccggcggcgattccc
ttcatggtgaggatcagcgtgtcctctagccccgggtcgtactcggtgct
ggggttgagctccaccaggctctcagccgttttttttttttttnttnttn
tnnngnnnntgngagnnntnnnggngggngggnggtggngnnntgngnng
nnnnnnnnnggnnnngnngngngnnnngnnnnnnnntnngngnnnnnnnn
nnnnntntnggnnnnnngnggnggnnngtngnnngnggnnntnntggntn
gtnnngnnttnnnngnggngnnngtgntnngnngangnggnnggntt
BLAST
BLAST Search

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.