Query (optional)   in Class  

GrainGenes Sequence Report: CDO203_WHE04E11.s1

[ Printable Version ]  [ Submit comment/correction ]

Sequence
CDO203_WHE04E11.s1
Probe
CDO203
DNA Homology
S59780115corn_BlastN
[ Show all 269 ]
DNA
aaacatatagaagtaacaataacaacgaactgttccacaaagcacagaaa
atatngctaaccacgcttactgtttggccagccaagagacaaaaccgata
catctaaacgtgccaaaacaatccaacagcagtcagaatgacacctaaag
taaacnaggcggtggtggtgcaggtgcatacgaagactgccatggcgctt
agtcgacctcctccatcttgctctcaccggcatcatcctccaggggtggc
atgtcggtgtcgtcagccgtggcctcctcatcctcatcaatgctcaggcc
aagcttgagcatgcggtggnatcctggtgccgaagtgttggggtcctcca
gctgaagccagaggtgagcagggaggtctcgaagancagcatcacgaggt
cctgacagacttgtcgttcctgtcagcatcggn
BLAST
BLAST Search