Query (optional)   in Class  

GrainGenes Sequence Report: CDO20_WHE2C0041

[ Printable Version ]  [ Submit comment/correction ]

Sequence
CDO20_WHE2C0041
Probe
CDO20
DNA Homology
AF013568146noncereal_BlastN
[ Show all 72 ]
DNA
aaaccaatggaacctcacaatgcaaactactacagccaggtaacaacaca
cagggtttggtcagcatttagcctattgcccaaaattcccgaggagacgc
tccaccgcagcatggacatttccagaggtagctgtcaacgctcggatgtt
ctccactgtgtcgaagaaccccatctcttggagctgagctagctgggttg
cgaangctcttccggtggcacacttngcgcatttngaananccaggncan
cgccagcancaagcccactgaacatgctcatcaagctgttgaggttaana
ttgcctngattantgcctncttgagtncgattctnggccagctttnttga
ccaaatttcgangtcatnggcctgcctggaattggaatttaattnctgca
attgtttnttgggggcggntaaacttttggaagaaaaatnttgattttng
aaananttctcntnantttngggggnttgatttct
BLAST
BLAST Search