Query (optional)   in Class  

GrainGenes Sequence Report: CDO20_WHE2C0042

[ Printable Version ]  [ Submit comment/correction ]

Sequence
CDO20_WHE2C0042
Probe
CDO20
DNA Homology
AF013568145noncereal_BlastN
[ Show all 49 ]
DNA
aaaccaatggaacctcacaatgcaaactactacanccaggtaacaacaca
cagggctttggtcagcatttagcctattgcccaaaattcccgaggagacg
ctccaccgcagcatggacatttccagaggtagctgtcaacgctcggatgt
tctccactgtgtcgaagaaccccatctcttggagctgagctagctgggtt
gcgaangctcttccggtggcacacttggcgcatttggaacacccaggcca
ccgccagcaccaagcccactgaacatgctcatcaagctgttgaggttaac
attgcctggattagtgcctgcttgagtccgatcctggccagcttgttgac
caattgcgacgtcatggcctgctggaatgaantaaatgcngcaatgnttc
tggggacgtcaaatgtcgngaaattctggagtctggaacatttctcncaa
ntgggggtttgantnccaccaagnnacggacatttggggnccngntnggc
aatggggtcanggncnccagggnagacaaaaagnttggcaccattggcnc
cangggaagggtttgcaaaaccggtcaanaggggncncgggcnnccccgg
tantncccannggggannccaatcnccnagggcncaatnnngnatcctgg
ggnnggaagcctgtgcnn
BLAST
BLAST Search