Query (optional)   in Class  

GrainGenes Sequence Report: CDO212_WHE2D0022

Sequence
CDO212_WHE2D0022
Probe
CDO212
DNA Homology
CELC18A11146noncereal_BlastN
[ Show all 25 ]
DNA
tggatacaacatagtttccaaatgtactgagttatttgaaccttctttct
caagccgtggcagctatacaatttatcagcctcagccaacatcagaagtt
caggccccagcaccacccggctaacggagacagtcagcatttagagtatg
ccatattaaatggtctctccaaagaatagtcccaagaaggcaacaacatc
gagggatgccaaatggttcacaatttcccttctcaagtttcttttccttc
catggtgacatttgcaaatcaattgataattttcagtcctcacaaatacc
tatgactaatgccgcatgaaaagaatagaactaactaaaatcgaaaaaga
taggagctcatgttgcacatgcatattctggcacaaaagacttttgcctg
actagctcgtgtagatcgtgaacaattttaatcaccggcatctggggggt
gctagttccnggcaatttngggacattactgggagctcgtcnggaccttg
ggcccaancagtnggnnaaaaatctttggtaatcggttncggggnattng
ngaancttccacntcctttccacaacgngggggacattgccagttnccgg
ccagggntatancctttaggaaaatnggggggccnganccntcgcccggg
aatgntcccnggccagctttggaatgnncagttcagcccntt
BLAST
BLAST Search