Query (optional)   in Class  

GrainGenes Sequence Report: CDO212_WHE2D0022

[ Printable Version ]  [ Submit comment/correction ]

Sequence
CDO212_WHE2D0022
Probe
CDO212
DNA Homology
[ Hide all but 1 of 25 ]
CELC18A11146noncereal_BlastN
HSAC002115121noncereal_BlastN
HSAC00211599noncereal_BlastN
AF001783126noncereal_BlastN
CEC54D10125noncereal_BlastN
CET27D1125noncereal_BlastN
HSCKIIA124noncereal_BlastN
AF035307123noncereal_BlastN
N21004135noncereal_EST
AA514748128noncereal_EST
AA393590123noncereal_EST
AA397784123noncereal_EST
H98855123noncereal_EST
H97653123noncereal_EST
N25656123noncereal_EST
N20159123noncereal_EST
AA663440123noncereal_EST
AA609130123noncereal_EST
N32247123noncereal_EST
N26744123noncereal_EST
H99374123noncereal_EST
AA443758123noncereal_EST
AA115119123noncereal_EST
AA377087122noncereal_EST
AA193821120noncereal_EST
DNA
tggatacaacatagtttccaaatgtactgagttatttgaaccttctttct
caagccgtggcagctatacaatttatcagcctcagccaacatcagaagtt
caggccccagcaccacccggctaacggagacagtcagcatttagagtatg
ccatattaaatggtctctccaaagaatagtcccaagaaggcaacaacatc
gagggatgccaaatggttcacaatttcccttctcaagtttcttttccttc
catggtgacatttgcaaatcaattgataattttcagtcctcacaaatacc
tatgactaatgccgcatgaaaagaatagaactaactaaaatcgaaaaaga
taggagctcatgttgcacatgcatattctggcacaaaagacttttgcctg
actagctcgtgtagatcgtgaacaattttaatcaccggcatctggggggt
gctagttccnggcaatttngggacattactgggagctcgtcnggaccttg
ggcccaancagtnggnnaaaaatctttggtaatcggttncggggnattng
ngaancttccacntcctttccacaacgngggggacattgccagttnccgg
ccagggntatancctttaggaaaatnggggggccnganccntcgcccggg
aatgntcccnggccagctttggaatgnncagttcagcccntt
BLAST
BLAST Search