Query (optional)   in Class  

GrainGenes Sequence Report: CDO213_WHE04E12.s1

[ Printable Version ]  [ Submit comment/correction ]

Sequence
CDO213_WHE04E12.s1
Probe
CDO213
DNA Homology
S69179317noncereal_BlastN
[ Show all 10 ]
DNA
ccaaaaaggcctgttacnacataatgagcaagtacatttatttggaatca
caaggcatatgcgtggacatgtacaccaaatgcacaccagacgtccgcac
ccacacgacacgtgctctcgccctgaataatataggagttgaaatgagtt
ttgagcttcaagaattgctcgagcaatggtgctctagaaaagaaagtaat
tccgagataatggtactgtggttgctggctggcatctcagaatctctcca
tcagcagtaaccgtatatgtttcagggtctacatcaattttcggaagtgt
gtcgttgagtttcatgtccaactttgttaaactgcgaacaccaccaacag
gcttccaccctctttcttantttgtactctggatgcaacatccagcttcc
ttagcagcctgctcacaaaatggcgatcggagtt
BLAST
BLAST Search