Query (optional)   in Class  

GrainGenes Sequence Report: CDO373_WHE2E0061

[ Printable Version ]  [ Submit comment/correction ]

Sequence
CDO373_WHE2E0061
Probe
CDO373
DNA
tttatttgagaggntccaaaccattcccaactaagcggcacaatacaaga
agaattnaagggnaagaanacncatntnacangntagcctaancatntgg
aggnttaagggcnaatacncacngntccaanatcccaancgnacaaancg
nncaaacaaanacggcgcaattggncagcanccaaagccaacaggngggn
gcngtttnngaaccngnccanngngagcncncaaaatncnnaaagcanca
nttggcaanggggtagcncnngnntcanttggnggcnaanaaggcntnat
aagtnctgnccanatggggnttggcggannncangntcatccaatccnaa
aangnaatcaaccnnantccngtnaannntccgnngntaangggnncggt
gtnngnnntangtnntntnnaaaggntgggnggtnaananccnttanagn
tnaggnccnntanaagnngcntcnaangnnttntnatanaggcncccaaa
gnnccntanggnngaaatnccttnttg
BLAST
BLAST Search