Query (optional)   in Class  

GrainGenes Sequence Report: CDO388_WHE2E0092

[ Printable Version ]  [ Submit comment/correction ]

Sequence
CDO388_WHE2E0092
Probe
CDO388
DNA Homology
ZMHSP705226corn_BlastN
[ Show all 254 ]
DNA
tattacttgacgtgaccagagatgtttccacaaaacaagttccagcttcg
aacacgtacttgcctaacaaagaccacttggtccaaacaatataagtctc
acacataacgaataaaatataggacgataactagcagcaggcctctgctg
gagcagaggcgccaacagaacggcgacaaaattagtcgacctcctcgatc
ttggggccagcaccgccggaagcagcnngggtgtcatcgtccatgccaac
ctccatgtcagcancagctccctggtacatcttggcganatggggtncac
aggnctccagctccttcatcttggcatcggactcatnagcctnagcgaac
tgggtgggtgtcgagccactgattgcagcgtcgaatggagggcntaancc
tcctcctgtccnncngccnggaannctnggaaggggtcttcncaancntn
gaaggngnggggnangttntaggngtaggtcnnccagggngnttcttggg
actnccacnttcntcctgggatccctaagcccnggantngnantttcang
ccnccggngncantttncaaancccncctngtnaagctagccnnnncntg
gggatgggntnnggnnttnnnccnnggttttccaangngaacgnncanga
ancgtngntnaagnnaaagnnnaannagttggggggaancnta
BLAST
BLAST Search