Query (optional)   in Class  

GrainGenes Sequence Report: CDO419_WHE04F06.s1

[ Printable Version ]  [ Submit comment/correction ]

Sequence
CDO419_WHE04F06.s1
Probe
CDO419
DNA Homology
TRMHSP70177noncereal_BlastN
[ Show all 118 ]
DNA
tcgggcaggccggcatccaggtttttttttttttttttattgcattgtac
gtgacagatagaaagtctgacattaatcgaaagtacaacaaaacttacat
cccaggtgatatgattggcacctgaggctgaaaacaaatgacgtatagtg
tatttctcactacatgaaattcatccaagacactagtggtataacttagt
cgacctcctcaatcttggggccagcacctcccgggggggggggggggggg
ggngggggnggnnnnaanaganngagnnnganaganagnnnnggangnng
angngngnnntgggnngnngnnnnnnngnnnnnntggnnaggagagnana
gnngngagnngganaagngngagnananngnaagngtgngnganaggngg
ntngtaggngngagngagnagggnntganggnnnganggnanggnngnna
ngngnggggagnngnnggggggggnt
BLAST
BLAST Search