Query (optional)   in Class  

GrainGenes Sequence Report: CDO465_WHE2G0092

[ Printable Version ]  [ Submit comment/correction ]

Sequence
CDO465_WHE2G0092
Probe
CDO465
DNA Homology
HVU46003857barley_BlastN
[ Show all 7 ]
DNA
ttttttttttttttttttttttatcgcaaaacctcaanaatgcatctctt
ttattgctaaaaaatccaccacaaactcatgtataggtatctcatctttc
aatcccaaccggaaaacttctcccatcttaattanctctcactgcattca
tttcttcgcctcggnggtgagcccgaacccgaacgggaacagcgggtcgn
agtgcttgtcgcccacgttcatcggcagctggtccaccgacttgaaccat
gtcctcgccagcttcccggagaacccatagtcgccgaanagcgcatcagc
aacgccctggccctctgtgccaggcagccatgcagccacgaacgcgttca
atggtgcngangtncggntccaccaaaaggggctcccgganantgagcac
cancagggattnntggttttgnngacggtttnaanccacnggggggcngg
nagnagggtcttgaggttcangnttttnggaaggtttngggnaggggggt
tcgcggacnaaccagntggnaaannggnantnncnctaaaggggnnangt
ccgggtntttgaanagaccnctntntnttnggggtccacngnggatttnt
ngccgagaggattnntgnnccaaanngtttttttgncannaanccttgna
ntggtttgnaancntcnaagnggtngccaantntggggggnt
BLAST
BLAST Search