Query (optional)   in Class  

GrainGenes Sequence Report: CDO504_WHE2E0122

[ Printable Version ]  [ Submit comment/correction ]

Sequence
CDO504_WHE2E0122
Probe
CDO504
DNA Homology
HSU37689228noncereal_BlastN
[ Show all 443 ]
DNA
caaggggaattattttatttcaattcttctagatgtgtggcacatcagta
caatcatggtctagtagagcaacaaatacaaacccttgggtaaagtaaac
atagttttcaccggctaagacacggtacaatcagaagagcaggctggccc
aagcagcaatgaatgcaaagccaccaattggtgctggtgaggagaacttc
ctgtcttcaaggtaagccacggtgtagcacgttccagagaagagcacaat
tccagtagtaagaagacctccgaagatgttggggcgcttggtgaggggag
ctccgagcaacgccgcggtgtggacgagatggtagagggaggcgatctgc
caagtatctttgtatctagggntctgggggcggaacatgtgcgctccgta
gtgcccaagtccaagagcagcaacgccggatacggggccancttgtggcc
atagcatcnggtccgngggcatcaccatcttcttctccctcttcgggtcg
tcgncttcngttngctcnggttttgtnccctcgtgncggatttcctncag
cccggggggtccactangtcnnaagnggcgncancgngttggagctnccn
gttttgttcccttagnggnggtaatttccagcttggggaanncnngnana
gctgtttcccgtgtgaaattttaaccgncaanattcccanantt
BLAST
BLAST Search