Query (optional)   in Class  

GrainGenes Sequence Report: CDO507-3

[ Submit comment/correction ]

Sequence
CDO507-3
Data Source
Kuenzel, Gottfried98.05.05
Probe
CDO507
DNA Homology
AA550141205noncereal_EST
[ Show all 205 ]
DNA
ttcattttaattatctgtaaggacaatgtaatcatatttgttttaaataa
taaaagtggaattttctgttacttgcaatctctcatttcttttattccct
tcaaggcaatgtaatgtttataattatgtttaatttctttttatacttga
ggcctgtaaatatggaatcttattcataaatagggattcaatccttattt
cttattattaattatctgttgtcatatcatattactttattagagaattt
acatcccattttccctatgtattcaaatattccctaattcaatttgtgaa
gtttctaacttcattt
BLAST
BLAST Search

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.