Query (optional)   in Class  

GrainGenes Sequence Report: CDO57-3

[ Printable Version ]  [ Submit comment/correction ]

Sequence
CDO57-3
External Databases
Data at GenBank
Data at EMBL
Data at DDBJ
Data Source
Kuenzel, Gottfried98.05.05
Probe
CDO57
DNA Homology
C285801752rice_EST
[ Show all 616 ]
DNA
gacaatgaccttctcaaccttgtcgccaagcacctccttgatgaccttgc
agagcccctcgaacttctccttgagctcctcctgcttcttcttctcatcc
tcgctctcatcaagcttgagcccctccttggtggcagaaacgagcttctt
gccctcaaactccttgagttggccaatagcatactcatcaatggcgtcaa
ccatgtagatgacctcatagcccttcttcctcagcttctcaaggaaggga
gagttctccacagccttcttgctctcaccagtgatgtagtaaatctcgtt
ctgtccctccttcatcctggtgacatagtccttcaggctcgtcagctcat
caccactcttggtggagtggtaccttagaagctcagcaatcttggtcctg
ttatgagagtcctcatggattccaagcttgaggttcttggagaatgcctc
gtagaacttgttgtagtcctccttgttctcagcaatttcaaagaagagct
caatgcacttcttcacaaggttcttcctgatgaccttgaggatcttgttc
tgctggagagtctcacgggagatgttgaggggaaggtcctcagagtcaac
aatgcccttgacgaagctcaggtactcagggatcaactcctcacagttgt
ccatgatgaagacacggcgcacatacagcttgatgttgttggccttctct
cgtgcc
BLAST
BLAST Search