Query (optional)   in Class  

GrainGenes Sequence Report: CDO57-5

Sequence
CDO57-5
External Databases
Data at GenBank
Data at EMBL
Data at DDBJ
Data Source
Kuenzel, Gottfried98.05.05
Probe
CDO57
DNA Homology
RICC1828A623rice_EST
[ Show all 335 ]
DNA
tgcagaaaacatagaaatagctaaacatattatagargtaacaataacaa
cgaactgttccacaaagcacagacgaatatagctaaccgcgcttactgtt
tggccavccaagagacaaaaccgatagagctaaacgtgccaaaaccatcc
aacagcagtcagaaagataaactaggcggtggtggtgcaggtgcaaacga
agactgccgtggcgcttagtcgacctcctccatcttgctctcaccagcat
catcctccaggggtggcatgtcggtgtcgttctcggtggcctcctcgtcc
tcatcaatgctcaggccgagcttgagcatgcggtggatcctggtgccgaa
ggtgttgggatcctccaggctgaagccaaaggtgagcagggaggtctcga
agagcagcatcaccaggtccttgacagacttgtcattcttg
BLAST
BLAST Search