Query (optional)   in Class  

GrainGenes Sequence Report: CDO57-5

[ Printable Version ]  [ Submit comment/correction ]

Sequence
CDO57-5
External Databases
Data at GenBank
Data at EMBL
Data at DDBJ
Data Source
Kuenzel, Gottfried98.05.05
Probe
CDO57
DNA Homology
[ Hide all but 1 of 335 ]
RICC1828A623rice_EST
RICC1828A314rice_EST
T18632616corn_EST
AA754562566rice_EST
D42694107rice_EST
D42694519rice_EST
AA753581551rice_EST
AA753581326rice_EST
AA754237267rice_EST
AA754237331rice_EST
AA75423787rice_EST
AI065772313corn_EST
AI065772547corn_EST
SSZ84177448noncereal_EST
SSZ84177121noncereal_EST
AT000204494noncereal_EST
D43337436rice_EST
D43337124rice_EST
AA557092463noncereal_EST
AA55709290noncereal_EST
C28172370rice_EST
C28172154rice_EST
AA582829432noncereal_EST
AA668581432noncereal_EST
AA143273432noncereal_EST
AA070356432noncereal_EST
AA558212432noncereal_EST
AA485929432noncereal_EST
AA604163432noncereal_EST
AA700630432noncereal_EST
AA670171432noncereal_EST
AA748781432noncereal_EST
AA573965432noncereal_EST
AA181325432noncereal_EST
AA488736432noncereal_EST
AA772997432noncereal_EST
AA492525432noncereal_EST
AA854939432noncereal_EST
AA599098432noncereal_EST
AA525799432noncereal_EST
AA379807432noncereal_EST
AA135628432noncereal_EST
AA101922432noncereal_EST
AA420611432noncereal_EST
AA173899432noncereal_EST
AA634879432noncereal_EST
AA487401432noncereal_EST
AA711617432noncereal_EST
H22618432noncereal_EST
AA791557430noncereal_EST
T59904429noncereal_EST
W56420427noncereal_EST
W56419427noncereal_EST
AA084465427noncereal_EST
AA130990426noncereal_EST
AA159526426noncereal_EST
AA159371426noncereal_EST
AA155641426noncereal_EST
AA074336426noncereal_EST
AA182781426noncereal_EST
AA069803426noncereal_EST
AA219666426noncereal_EST
AA190896426noncereal_EST
AA385702426noncereal_EST
AA323689426noncereal_EST
C79312423noncereal_EST
AA179388423noncereal_EST
AI033519423noncereal_EST
AA067616423noncereal_EST
AA158903423noncereal_EST
AA664215423noncereal_EST
AA158944423noncereal_EST
AA573205423noncereal_EST
AI132215423noncereal_EST
AA408804423noncereal_EST
AA775061423noncereal_EST
AA596637423noncereal_EST
AA913960423noncereal_EST
AA399934423noncereal_EST
AA710962423noncereal_EST
AA396984423noncereal_EST
AA718352423noncereal_EST
AA562141423noncereal_EST
AA544426423noncereal_EST
AA218077423noncereal_EST
W08790423noncereal_EST
AA105713423noncereal_EST
AA208961423noncereal_EST
AA536788423noncereal_EST
AA399892423noncereal_EST
AA275647423noncereal_EST
AA118139423noncereal_EST
AA030123423noncereal_EST
AA756709423noncereal_EST
AA432871423noncereal_EST
AA105721423noncereal_EST
AA009296423noncereal_EST
AA603895423noncereal_EST
AA434851423noncereal_EST
AA049340423noncereal_EST
AA035967423noncereal_EST
AA538540423noncereal_EST
AA981272423noncereal_EST
AI036018423noncereal_EST
AA980092423noncereal_EST
AA208455423noncereal_EST
AA139538423noncereal_EST
AA014270423noncereal_EST
AA500948423noncereal_EST
AA710299423noncereal_EST
AA692233423noncereal_EST
AA386425423noncereal_EST
W81835423noncereal_EST
AA797918423noncereal_EST
AA615780423noncereal_EST
AA656048423noncereal_EST
AA120185423noncereal_EST
AA981148423noncereal_EST
AA215152423noncereal_EST
AA104943423noncereal_EST
W87156423noncereal_EST
W65860423noncereal_EST
AA051310423noncereal_EST
W41132423noncereal_EST
AA162622423noncereal_EST
W82439423noncereal_EST
AA795640423noncereal_EST
AA259735423noncereal_EST
AA087424423noncereal_EST
AA529443421noncereal_EST
W80257421noncereal_EST
AA432478421noncereal_EST
AA435161421noncereal_EST
AI043045420noncereal_EST
AA372987420noncereal_EST
AA031242420noncereal_EST
AA75209186rice_EST
AA752091318rice_EST
AA752091155rice_EST
AA752091234rice_EST
H50320419noncereal_EST
AA284704418noncereal_EST
AA754651318rice_EST
AA754651417rice_EST
AA485642417noncereal_EST
AA695216389noncereal_EST
AA69521699noncereal_EST
AA932101414noncereal_EST
AA772156414noncereal_EST
AA896564414noncereal_EST
AA570258414noncereal_EST
AA412863414noncereal_EST
AA125578414noncereal_EST
AA696255389noncereal_EST
AA69625599noncereal_EST
AA670453412noncereal_EST
AA834135412noncereal_EST
T72269411noncereal_EST
AA837022408noncereal_EST
N59975364noncereal_EST
N59975115noncereal_EST
AA801918380noncereal_EST
AA80191899noncereal_EST
AI037027405noncereal_EST
AA608599405noncereal_EST
AA277330405noncereal_EST
AA104935405noncereal_EST
AA529276405noncereal_EST
C78864402noncereal_EST
AA321004402noncereal_EST
AA361894373noncereal_EST
AA36189498noncereal_EST
H94609370noncereal_EST
H9460998noncereal_EST
AA025715370noncereal_EST
AA02571598noncereal_EST
AA544019396noncereal_EST
AA098049396noncereal_EST
AA751905290rice_EST
AA751905176rice_EST
AA474500393noncereal_EST
AA590760393noncereal_EST
AA562731393noncereal_EST
AA690326393noncereal_EST
AA657152393noncereal_EST
AA560364393noncereal_EST
AA896856393noncereal_EST
AA636986393noncereal_EST
AA138040393noncereal_EST
AI037445393noncereal_EST
AA259449393noncereal_EST
AA312400364noncereal_EST
AA31240098noncereal_EST
W83135391noncereal_EST
AA309988364noncereal_EST
AA30998898noncereal_EST
AA753917171rice_EST
AA753917130rice_EST
AA753917226rice_EST
AA949750389noncereal_EST
AA815826388noncereal_EST
AI138526387noncereal_EST
AA822802387noncereal_EST
AA371492370noncereal_EST
AA37149283noncereal_EST
AA586678382noncereal_EST
AA372480370noncereal_EST
AA37248080noncereal_EST
R02808370noncereal_EST
R0280880noncereal_EST
R10022370noncereal_EST
R1002280noncereal_EST
T63354380noncereal_EST
AA531724335noncereal_EST
AA531724115noncereal_EST
AI043514375noncereal_EST
AA670998374noncereal_EST
W56527370noncereal_EST
AA319049370noncereal_EST
T54413370noncereal_EST
AI057800370noncereal_EST
R09298370noncereal_EST
AA599542366noncereal_EST
AI158885366noncereal_EST
AI132560366noncereal_EST
AI131213365noncereal_EST
AA519670197noncereal_EST
AA519670189noncereal_EST
AA519670115noncereal_EST
AA300826364noncereal_EST
AA531746197noncereal_EST
AA531746189noncereal_EST
AA531746115noncereal_EST
AA161206363noncereal_EST
AA320179363noncereal_EST
OSHSP82MR620rice_BlastN
OSHSP82MR86rice_BlastN
OSHSP82MR300rice_BlastN
S59780625corn_BlastN
OSHSP82G623rice_BlastN
OSHSP82G326rice_BlastN
OSHSP82A594rice_BlastN
OSHSP82A306rice_BlastN
RICNH67107rice_BlastN
RICNH67519rice_BlastN
AB011476147noncereal_BlastN
AB011476466noncereal_BlastN
AB011476129noncereal_BlastN
AB011476493noncereal_BlastN
AB011476138noncereal_BlastN
TOMHSC80P468noncereal_BlastN
TOMHSC80P143noncereal_BlastN
SSU94395454noncereal_BlastN
SSU94395155noncereal_BlastN
RICYK21522rice_BlastN
RICYK21306rice_BlastN
ATHSP812466noncereal_BlastN
ATHSP812129noncereal_BlastN
RICAD167313rice_BlastN
RICAD167266rice_BlastN
ATHHSP83391noncereal_BlastN
ATHHSP83176noncereal_BlastN
ATHHSP81391noncereal_BlastN
ATHHSP81176noncereal_BlastN
ATHSP90A382noncereal_BlastN
ATHSP90A176noncereal_BlastN
PHNHSP83A416noncereal_BlastN
PHNHSP83A137noncereal_BlastN
AF042329407noncereal_BlastN
AF042329116noncereal_BlastN
LEIHSP90440noncereal_BlastN
CRUHSP90A384noncereal_BlastN
CRUHSP90A131noncereal_BlastN
HUMHSP90432noncereal_BlastN
S46109423noncereal_BlastN
MUSHSP84B423noncereal_BlastN
MUSHSP84A414noncereal_BlastN
NTHSP82414noncereal_BlastN
NTHSP82199noncereal_BlastN
DMHSP82389noncereal_BlastN
DMHSP8299noncereal_BlastN
DAU75687393noncereal_BlastN
DAU7568783noncereal_BlastN
MUSHSP86A393noncereal_BlastN
MMHSP86PH393noncereal_BlastN
D87666370noncereal_BlastN
D8766698noncereal_BlastN
AF028832370noncereal_BlastN
AF02883298noncereal_BlastN
HSHSP90R370noncereal_BlastN
HSHSP90R98noncereal_BlastN
GGHSP90B386noncereal_BlastN
GGHSPAA380noncereal_BlastN
SMRHSC90R310noncereal_BlastN
SMRHSC90R141noncereal_BlastN
TRBHSC370noncereal_BlastN
HUMHSP90B366noncereal_BlastN
HUMHSP89KD323noncereal_BlastN
HUMHSP89KD98noncereal_BlastN
PAU81165306noncereal_BlastN
PAU81165100noncereal_BlastN
AFU92465287noncereal_BlastN
AFU92465104noncereal_BlastN
TBHSP83301noncereal_BlastN
THEHSP90294noncereal_BlastN
CEC47E8289noncereal_BlastN
CEC47E891noncereal_BlastN
LPAJ5049275noncereal_BlastN
HTOHSP82271noncereal_BlastN
LIHSP83GN259noncereal_BlastN
SCYPL240C248noncereal_BlastN
SC38KCXVI248noncereal_BlastN
YSCHSP82A248noncereal_BlastN
SC8010212noncereal_BlastN
YSCHSC82212noncereal_BlastN
OSHSC70A177rice_BlastN
ATHSP814147noncereal_BlastN
S77849147noncereal_BlastN
HEMMRNAB132noncereal_BlastN
SCL122A131noncereal_BlastN
SCL121A131noncereal_BlastN
YSPHSP90X128noncereal_BlastN
CELR13D11125noncereal_BlastN
OSU95968125oat_BlastN
SBU4165391grass_BlastN
SBU41653107grass_BlastN
BLYMUB2123barley_BlastN
PSEFAOA122noncereal_BlastN
HSGSYG13122noncereal_BlastN
HUMGLYSA122noncereal_BlastN
HSU32573122noncereal_BlastN
MMMHC29N7121noncereal_BlastN
CER09E10121noncereal_BlastN
AB006961121noncereal_BlastN
HSMLN51121noncereal_BlastN
DNA
tgcagaaaacatagaaatagctaaacatattatagargtaacaataacaa
cgaactgttccacaaagcacagacgaatatagctaaccgcgcttactgtt
tggccavccaagagacaaaaccgatagagctaaacgtgccaaaaccatcc
aacagcagtcagaaagataaactaggcggtggtggtgcaggtgcaaacga
agactgccgtggcgcttagtcgacctcctccatcttgctctcaccagcat
catcctccaggggtggcatgtcggtgtcgttctcggtggcctcctcgtcc
tcatcaatgctcaggccgagcttgagcatgcggtggatcctggtgccgaa
ggtgttgggatcctccaggctgaagccaaaggtgagcagggaggtctcga
agagcagcatcaccaggtccttgacagacttgtcattcttg
BLAST
BLAST Search