Query (optional)   in Class  

GrainGenes Sequence Report: CDO583_WHE03A04.r1

[ Printable Version ]  [ Submit comment/correction ]

Sequence
CDO583_WHE03A04.r1
Probe
CDO583
DNA Homology
HVBTUBI960barley_BlastN
[ Show all 428 ]
DNA
atcggtgccaagttctgggaggtggtgtgtgacgagcacggcattgaccc
aactgggcggtacgtcggcacttctgacctgcagttggagcgtgtcaatg
tctactacaacgaggcctcatgtgggcgctttgtgccccgtgctgtgctc
atggaccttgagcccggtaccatggacagtgtccgcactggaccctatgg
gcagatcttccgncctganaaanatttntttttggggnaatctggtnggg
ggnaananttggggccaagggncaataacaccggggggtgtngaacttta
nnggantccnggttnnngatnttntnaaggaangggggctnnaaaaatgt
gnctnccttgnaagganttccaangtangccacnccnctngggggggggg
naanggatctgggcaagggncccccggttgatatccaaaatccngggaaa
annancctaanccgnangggccccaaaatcccagggtnccccccaaaaan
nggtcgnaaanngggggttnaccaaa
BLAST
BLAST Search