Query (optional)   in Class  

GrainGenes Sequence Report: CDO64-5

[ Printable Version ]  [ Submit comment/correction ]

Sequence
CDO64-5
Data Source
Kuenzel, Gottfried98.05.05
Probe
CDO64
DNA Homology
RICS3918A1483rice_EST
[ Show all 623 ]
DNA
taagaaacaccagctttccattgatactagaagagtcaaacataagttga
tgaagaaatatactacaaacgggcccaactgcaatcaggatacaccaggg
aggggcaagttcacataaacacttgagaggtctggaaacacactggatag
aaggagcatagcacgaattgcgtcgtccgttttagcagctacagctagta
ggatgcttaactggaaatcgatcgaataagagttcagatcttaaactaat
atgcaatgcacagtctccggggcacgttcgatgctcatttggccatcatg
accttgacaaactcctcgtagttgatctggccatcaccatcaacatcagc
ttcacggatcatctcgtcgacctcctcgtcggttagcttctcgccaaggt
ttgtcatgacgtggcggagctcagcagcagagatgaagccattttggtcc
ttgtcgaacaccctgaaggcctccttgagctcttcctctgagtcagtgtc
cttcatcttgcgagccatcaggttgagaaactctgggaaatcaatggttc
cattgccatcagcatcgacttcgttgatcatgtcctggagctcagcctcc
gttgggttctgccccagtgaacgcatgaccgttcccagctccttggktgt
gatgcaaccatctctcgtgscggaattcctggcagcccggggg
BLAST
BLAST Search