Query (optional)   in Class  

GrainGenes Sequence Report: CDO64-5

[ Printable Version ]  [ Submit comment/correction ]

Sequence
CDO64-5
Data Source
Kuenzel, Gottfried98.05.05
Probe
CDO64
DNA Homology
[ Hide all but 1 of 623 ]
RICS3918A1483rice_EST
RICS3918A327rice_EST
AA6603671413noncereal_EST
AA660367300noncereal_EST
AA720465933noncereal_EST
AA720465431noncereal_EST
AA720465363noncereal_EST
C284551146rice_EST
C28455174rice_EST
AA660338924noncereal_EST
AA660338244noncereal_EST
AA660338191noncereal_EST
AA660338300noncereal_EST
AA7287431076noncereal_EST
AA728743200noncereal_EST
AA8511011166noncereal_EST
AA7132761160noncereal_EST
Z181621123noncereal_EST
C883961101noncereal_EST
RICS3036A1095rice_EST
RICS3036A327rice_EST
AA2726081093noncereal_EST
AA0286021092noncereal_EST
AA0283471090noncereal_EST
AA1090411085noncereal_EST
AA109041273noncereal_EST
AA0028961082noncereal_EST
W284911082noncereal_EST
AA4086461079noncereal_EST
AA7899471076noncereal_EST
AA7899491076noncereal_EST
AA0300621076noncereal_EST
AA0323341076noncereal_EST
AA0718161076noncereal_EST
AA0607241076noncereal_EST
AA0304071076noncereal_EST
AA0870021076noncereal_EST
AA2420011076noncereal_EST
AA0362691076noncereal_EST
AA1058461076noncereal_EST
W909141076noncereal_EST
AA2537921076noncereal_EST
AA5971551076noncereal_EST
AA8407461071noncereal_EST
AA8599971070noncereal_EST
AA0087241070noncereal_EST
C72711907rice_EST
C72711241rice_EST
C72711327rice_EST
N970371068noncereal_EST
AA6242501067noncereal_EST
AA7915961067noncereal_EST
AA0231531067noncereal_EST
AA1050391067noncereal_EST
AA7944951067noncereal_EST
AA1044961067noncereal_EST
W894691066noncereal_EST
AA0607301063noncereal_EST
AA0492811062noncereal_EST
AA5180331062noncereal_EST
W646901062noncereal_EST
AA7707861062noncereal_EST
AA415552626noncereal_EST
AA415552516noncereal_EST
AA2739131060noncereal_EST
AA0871461058noncereal_EST
AA2387341057noncereal_EST
AA7037081057noncereal_EST
AA1030891056noncereal_EST
AA616371626noncereal_EST
AA616371511noncereal_EST
AA1539331053noncereal_EST
C880731052noncereal_EST
AA2397361051noncereal_EST
W107141051noncereal_EST
AA6741511051noncereal_EST
AA0346201049noncereal_EST
AA6930221047noncereal_EST
AU0172391047noncereal_EST
AA880156611noncereal_EST
AA880156516noncereal_EST
AA4999371045noncereal_EST
W75717225noncereal_EST
W75717900noncereal_EST
W75717187noncereal_EST
W97162225noncereal_EST
W97162900noncereal_EST
W97162187noncereal_EST
N651151043noncereal_EST
AA5383201030noncereal_EST
RICC0010A1029rice_EST
RICC0010A327rice_EST
W987871029noncereal_EST
AA038889220noncereal_EST
AA038889887noncereal_EST
AA038889182noncereal_EST
AA2717421024noncereal_EST
AA2312201022noncereal_EST
AA2551621021noncereal_EST
AA1984431021noncereal_EST
AA0563651016noncereal_EST
AA3077191013noncereal_EST
AA0625591013noncereal_EST
AA3118281013noncereal_EST
T425291008noncereal_EST
AA024048230noncereal_EST
AA024048859noncereal_EST
AA024048192noncereal_EST
AA1654481007noncereal_EST
AA6840271005noncereal_EST
AA711831351noncereal_EST
AA711831730noncereal_EST
C88628999noncereal_EST
C88521997noncereal_EST
AA871164996noncereal_EST
W83513659noncereal_EST
W83513414noncereal_EST
AA396816993noncereal_EST
AA626500992noncereal_EST
AA270734220noncereal_EST
AA270734851noncereal_EST
AA270734182noncereal_EST
AA058146626noncereal_EST
AA058146444noncereal_EST
C73257248rice_EST
C73257509rice_EST
C73257381rice_EST
C73257167rice_EST
AA645062987noncereal_EST
AA307905987noncereal_EST
W89674756noncereal_EST
W89674310noncereal_EST
AA713226985noncereal_EST
AA840613909noncereal_EST
AA840613155noncereal_EST
AA081324984noncereal_EST
AA261339984noncereal_EST
AA274973239noncereal_EST
AA274973824noncereal_EST
AA315518978noncereal_EST
AA396694976noncereal_EST
W29648976noncereal_EST
W61406976noncereal_EST
C93709973noncereal_EST
W83364688noncereal_EST
W83364364noncereal_EST
C91967964noncereal_EST
C92685964noncereal_EST
C94461964noncereal_EST
C91342964noncereal_EST
C90427964noncereal_EST
C89654964noncereal_EST
C94390964noncereal_EST
W71431963noncereal_EST
AA000519626noncereal_EST
AA000519414noncereal_EST
AA245104608noncereal_EST
AA245104429noncereal_EST
AA130210954noncereal_EST
AA408771951noncereal_EST
W85034948noncereal_EST
AA220765120noncereal_EST
AA220765904noncereal_EST
AA577290939noncereal_EST
W89787617noncereal_EST
W89787402noncereal_EST
AA684346935noncereal_EST
AA151806504noncereal_EST
AA151806507noncereal_EST
AU024525926noncereal_EST
AA650760924noncereal_EST
AA843651921noncereal_EST
AA214983919noncereal_EST
AA423153919noncereal_EST
AA423153288noncereal_EST
C74968909rice_EST
AA546104659noncereal_EST
AA546104326noncereal_EST
T20450903noncereal_EST
AA608790903noncereal_EST
AA590586196noncereal_EST
AA590586785noncereal_EST
AA673197894noncereal_EST
AA466257543noncereal_EST
AA466257429noncereal_EST
AA187557628noncereal_EST
AA187557341noncereal_EST
W49440885corn_EST
W49440269corn_EST
AA413574885noncereal_EST
W91420659noncereal_EST
W91420304noncereal_EST
AU022007881noncereal_EST
T43045879noncereal_EST
AA611591879noncereal_EST
C49579876noncereal_EST
C49579134noncereal_EST
W46012230noncereal_EST
W46012120noncereal_EST
W46012678noncereal_EST
W46012192noncereal_EST
AA591899656noncereal_EST
AA591899296noncereal_EST
T55981873noncereal_EST
AA063904873noncereal_EST
AA755895871noncereal_EST
RICC0419A870rice_EST
RICC0419A357rice_EST
C04208867noncereal_EST
C39340866noncereal_EST
C39340157noncereal_EST
AA409434864noncereal_EST
AA871618345noncereal_EST
AA871618596noncereal_EST
C50634860noncereal_EST
C50634157noncereal_EST
AA656912136noncereal_EST
AA656912351noncereal_EST
AA656912516noncereal_EST
AA188391820noncereal_EST
AA188391108noncereal_EST
AU019406577noncereal_EST
AU019406351noncereal_EST
C05451846noncereal_EST
AA538358844noncereal_EST
AA498530844noncereal_EST
RICR1753A842rice_EST
RICR1753A327rice_EST
AA408862837noncereal_EST
AA408836837noncereal_EST
C39359833noncereal_EST
C39359157noncereal_EST
AA656979120noncereal_EST
AA656979312noncereal_EST
AA656979549noncereal_EST
C44032830noncereal_EST
C44032207noncereal_EST
C89306829noncereal_EST
W78405230noncereal_EST
W78405675noncereal_EST
W78405192noncereal_EST
C43376825noncereal_EST
C43376134noncereal_EST
AA671896507noncereal_EST
AA671896398noncereal_EST
R84593822noncereal_EST
AA713132815noncereal_EST
AA264512815noncereal_EST
AA637500335noncereal_EST
AA637500558noncereal_EST
AA271946811noncereal_EST
AA036006626noncereal_EST
AA036006264noncereal_EST
AA596878806noncereal_EST
C42866806noncereal_EST
C42866134noncereal_EST
H34918806noncereal_EST
N38696805noncereal_EST
N38696282noncereal_EST
AA923140805noncereal_EST
C66314804noncereal_EST
C66314160noncereal_EST
W41777797noncereal_EST
T46038350noncereal_EST
T46038490noncereal_EST
T46038102noncereal_EST
T46038210noncereal_EST
AA413922792noncereal_EST
C85276577noncereal_EST
C85276247noncereal_EST
C85276118noncereal_EST
AA407900786noncereal_EST
AA409979659noncereal_EST
AA409979202noncereal_EST
AA122637780noncereal_EST
AA122637282noncereal_EST
C41957778noncereal_EST
C41957127noncereal_EST
AA011783777noncereal_EST
AA011783225noncereal_EST
C50145774noncereal_EST
C50145157noncereal_EST
W39415774noncereal_EST
AA375959571noncereal_EST
AA375959190noncereal_EST
AA375959158noncereal_EST
AA054976768noncereal_EST
AA316337765noncereal_EST
BLYCAMA1733barley_BlastN
BLYCAMA176barley_BlastN
BLYCAMA113barley_BlastN
BLYCAMA382barley_BlastN
BLYCAMA137barley_BlastN
BLYCAMA354barley_BlastN
TAU491041718wheat_BlastN
TAU49104176wheat_BlastN
TAU49104113wheat_BlastN
TAU49104235wheat_BlastN
TAU49104354wheat_BlastN
TAU49104221wheat_BlastN
TAU491031697wheat_BlastN
TAU49103176wheat_BlastN
TAU49103113wheat_BlastN
TAU49103206wheat_BlastN
TAU49103354wheat_BlastN
TAU486931733wheat_BlastN
TAU48693176wheat_BlastN
TAU48693113wheat_BlastN
TAU48693157wheat_BlastN
TAU48693363wheat_BlastN
OSCALMOD11652rice_BlastN
OSCALMOD1327rice_BlastN
AF0428401567oat_BlastN
AF042840327oat_BlastN
TAU491051563wheat_BlastN
TAU4910584wheat_BlastN
ZMCAM11550corn_BlastN
ZMCAM193corn_BlastN
ZMCAM1363corn_BlastN
OSCALM1544rice_BlastN
OSCALM345rice_BlastN
LLCALMOD1517noncereal_BlastN
ZMCALMODU1499corn_BlastN
AF0428391487oat_BlastN
AF042839354oat_BlastN
ZMCAM21486corn_BlastN
ZMCAM2327corn_BlastN
VIRCALMODU1478noncereal_BlastN
VIRCALMODU318noncereal_BlastN
AF0314821464corn_BlastN
AF031482327corn_BlastN
ZMRNCAL1461corn_BlastN
ZMRNCAL327corn_BlastN
NPAJ50401453noncereal_BlastN
TAU486921450wheat_BlastN
TAU48692273wheat_BlastN
TAU486891446wheat_BlastN
TAU48689336wheat_BlastN
STU202951444noncereal_BlastN
PETCALPRO1443noncereal_BlastN
TAU486911441wheat_BlastN
TAU48691264wheat_BlastN
TAU486881437wheat_BlastN
TAU48688309wheat_BlastN
TAU482421437wheat_BlastN
TAU48242309wheat_BlastN
TAU486901434wheat_BlastN
PETCAM811434noncereal_BlastN
SOYSCAM3X1433noncereal_BlastN
STU202961427noncereal_BlastN
SOYSCAM2X1416noncereal_BlastN
SOYSCAM2X309noncereal_BlastN
OSCALMOD21416rice_BlastN
OSCALMOD2144rice_BlastN
STU202931411noncereal_BlastN
ATHCAM3COL1409noncereal_BlastN
ATHCAM3COL282noncereal_BlastN
STU202911402noncereal_BlastN
S815941397noncereal_BlastN
S81594318noncereal_BlastN
ATHCAM31393noncereal_BlastN
BYNCALMOD1391noncereal_BlastN
BYNCALMOD336noncereal_BlastN
SOYSCAM1X1391noncereal_BlastN
BNU101501391noncereal_BlastN
VIRCALMOD1388noncereal_BlastN
VIRCALMOD309noncereal_BlastN
PSU138821383noncereal_BlastN
STU202941382noncereal_BlastN
STU20294363noncereal_BlastN
MSCAL11382noncereal_BlastN
STU202971373noncereal_BlastN
STU20297327noncereal_BlastN
CACAM1373noncereal_BlastN
ATHCAM11373noncereal_BlastN
BNACALM1373noncereal_BlastN
BNACALM318noncereal_BlastN
MDCAMR1373noncereal_BlastN
MDCAMR345noncereal_BlastN
AB0168731357noncereal_BlastN
AB016873233noncereal_BlastN
ATCMACAM41357noncereal_BlastN
CAU834021355noncereal_BlastN
CACAM21355noncereal_BlastN
HAU797361353noncereal_BlastN
HAU79736309noncereal_BlastN
PHTCALPIA1349noncereal_BlastN
PHTCALPIA264noncereal_BlastN
STU202921348noncereal_BlastN
MDCAMG1348noncereal_BlastN
MDCAMG140noncereal_BlastN
ATCMACAM51341noncereal_BlastN
ATCMACAM5300noncereal_BlastN
DCCAM1G1337noncereal_BlastN
DCCAM1G327noncereal_BlastN
ATCMACAM61330noncereal_BlastN
AF0645521326noncereal_BlastN
ATAC004261609noncereal_BlastN
ATAC0042611325noncereal_BlastN
ATAC004261162noncereal_BlastN
ATAC004261135noncereal_BlastN
ATAC004261126noncereal_BlastN
ATAC004261409noncereal_BlastN
ATAC004261388noncereal_BlastN
ATCAL1325noncereal_BlastN
ATCAL126noncereal_BlastN
ATHCRP388noncereal_BlastN
ATHCRP409noncereal_BlastN
ATHCRP126noncereal_BlastN
ATHCRP1325noncereal_BlastN
ATHCRP135noncereal_BlastN
ATHCRP162noncereal_BlastN
BPCALMGEN1312noncereal_BlastN
NPAJ50391301noncereal_BlastN
MPCAM1291noncereal_BlastN
MPCAM313noncereal_BlastN
ATHCAM21280noncereal_BlastN
TCCALB21275noncereal_BlastN
TCCALB2273noncereal_BlastN
AF0078891261noncereal_BlastN
AF007889271noncereal_BlastN
PPCAMPROT1237noncereal_BlastN
MSCALMODU1219noncereal_BlastN
AF0644561218oat_BlastN
AF064456141oat_BlastN
OSU379361209oat_BlastN
OSU37936313oat_BlastN
TOMCALM1LE1202noncereal_BlastN
TOMCALM1LE273noncereal_BlastN
POTCAM1202noncereal_BlastN
POTCAM282noncereal_BlastN
LTCAMA1201noncereal_BlastN
LTCAMA277noncereal_BlastN
CAN0106451193noncereal_BlastN
SYNARBCAL1184noncereal_BlastN
SYNARBCAL297noncereal_BlastN
ACKCAL1175noncereal_BlastN
SYNGCAL1174noncereal_BlastN
AF0832381174noncereal_BlastN
SYNCAM1174noncereal_BlastN
SLECALMODU1170noncereal_BlastN
RSPRCM41166noncereal_BlastN
RATCAMB1166noncereal_BlastN
CICAM1166noncereal_BlastN
CICAM246noncereal_BlastN
AF0832371165noncereal_BlastN
ORZCAMB1164noncereal_BlastN
ORZCAMB282noncereal_BlastN
BFRNAC1157noncereal_BlastN
BFRNAC336noncereal_BlastN
AB0030821157noncereal_BlastN
AB003082336noncereal_BlastN
AB0030811148noncereal_BlastN
TRBCMRSG1147noncereal_BlastN
TBCALUBG1147noncereal_BlastN
BLRNAC1139noncereal_BlastN
MMCALMOD1139noncereal_BlastN
MUSCALMDB1134noncereal_BlastN
MUSCALMDA1130noncereal_BlastN
MUSCALMDA288noncereal_BlastN
NCCALMOE1122noncereal_BlastN
NCCALMOE237noncereal_BlastN
RNRCM11121noncereal_BlastN
DMCAMR1121noncereal_BlastN
NEUCLMDLN1113noncereal_BlastN
NEUCLMDLN237noncereal_BlastN
CACAM11107noncereal_BlastN
CACAM1386noncereal_BlastN
HUMCAMA1103noncereal_BlastN
HUMCAMA279noncereal_BlastN
ELCCALMA1094noncereal_BlastN
ELCCAMEEL1094noncereal_BlastN
AF0349641085noncereal_BlastN
AF034964264noncereal_BlastN
PETRCAM72A1085noncereal_BlastN
LEY147641085noncereal_BlastN
LEY14764336noncereal_BlastN
RATCAMA1084noncereal_BlastN
ORZCAMD1083noncereal_BlastN
ORZCAMA1083noncereal_BlastN
ORZCAMA297noncereal_BlastN
ORZCAMC1079noncereal_BlastN
ORZCAMC228noncereal_BlastN
TGCM1079noncereal_BlastN
CHKCM111076noncereal_BlastN
RATCAM1076noncereal_BlastN
MUSCAM1067noncereal_BlastN
ACCALM1066noncereal_BlastN
HUMCALPS1054noncereal_BlastN
HUMCALPS240noncereal_BlastN
AB0030831054noncereal_BlastN
AB003083306noncereal_BlastN
HSCAMPSG1054noncereal_BlastN
HSCAMPSG240noncereal_BlastN
HUMNB11054noncereal_BlastN
HUMNB1240noncereal_BlastN
XELCAMB1049noncereal_BlastN
XELCAMB270noncereal_BlastN
TTCALM1044noncereal_BlastN
XELCAMA1040noncereal_BlastN
XELCAMA243noncereal_BlastN
TETCALW1037noncereal_BlastN
CELT21H3597noncereal_BlastN
CELT21H3538noncereal_BlastN
CELT21H3242noncereal_BlastN
HUMCALCBP1031noncereal_BlastN
FSCAMF11024noncereal_BlastN
FSCAMF1345noncereal_BlastN
FSCAMF1368noncereal_BlastN
HSU447581022noncereal_BlastN
SOYSCAM4X1015noncereal_BlastN
CHKCALMA1013noncereal_BlastN
HUMALDN1013noncereal_BlastN
HUMCAM1004noncereal_BlastN
SOYCAM51002noncereal_BlastN
DSU628651002noncereal_BlastN
NGU043811002noncereal_BlastN
DUKCA995noncereal_BlastN
AF081672988noncereal_BlastN
S68025979noncereal_BlastN
PARCAM979noncereal_BlastN
CHKCABPL978noncereal_BlastN
HCCMD969noncereal_BlastN
HCCMD185noncereal_BlastN
DDICAL964noncereal_BlastN
CRECAM540noncereal_BlastN
CRECAM256noncereal_BlastN
CRECAM254noncereal_BlastN
CRECAM155noncereal_BlastN
NEUCALMDLN402noncereal_BlastN
NEUCALMDLN634noncereal_BlastN
RNCAMII3607noncereal_BlastN
RNCAMII3420noncereal_BlastN
RNCAMIII360noncereal_BlastN
RNCAMIII329noncereal_BlastN
RNCAMIII430noncereal_BlastN
MUSCAMC925noncereal_BlastN
HSCALM3912noncereal_BlastN
PSU13736912noncereal_BlastN
EMECALM375noncereal_BlastN
EMECALM612noncereal_BlastN
ASNCMDA375rice_BlastN
ASNCMDA607rice_BlastN
LEY14765890noncereal_BlastN
LEY14765363noncereal_BlastN
RNCALP238noncereal_BlastN
RNCALP708noncereal_BlastN
PFACALMO852noncereal_BlastN
PFACAM852noncereal_BlastN
PFCALM850noncereal_BlastN
BLCAML2247noncereal_BlastN
BLCAML2402noncereal_BlastN
BLCAML2356noncereal_BlastN
BLCAML2399noncereal_BlastN
BLCAML2208noncereal_BlastN
AF072882384noncereal_BlastN
AF072882536noncereal_BlastN
FSCAMFPRO799noncereal_BlastN
FSCAMFPRO179noncereal_BlastN
FSCAMFPRO368noncereal_BlastN
HSCALM777noncereal_BlastN
AC005242287noncereal_BlastN
AC005242597noncereal_BlastN
AF034988746noncereal_BlastN
DMCALM3743noncereal_BlastN
RNCAMIIPS209noncereal_BlastN
RNCAMIIPS606noncereal_BlastN
RICYK5732rice_BlastN
CTU15993375noncereal_BlastN
CTU15993420noncereal_BlastN
CTU15993261noncereal_BlastN
RNCAMI3381noncereal_BlastN
RNCAMI3420noncereal_BlastN
RNCAMI3286noncereal_BlastN
BLAJ1919711noncereal_BlastN
DMCAMR97A705noncereal_BlastN
DMCAMR97A235noncereal_BlastN
ACCAM2653noncereal_BlastN
HSCALMG2375noncereal_BlastN
HSCALMG2357noncereal_BlastN
YSPCAM1A640noncereal_BlastN
SPAC3A12640noncereal_BlastN
HSCALM2S04321noncereal_BlastN
HSCALM2S04394noncereal_BlastN
YSACMD1610noncereal_BlastN
BLCAML1256noncereal_BlastN
BLCAML1435noncereal_BlastN
AF020781479noncereal_BlastN
AF020781207noncereal_BlastN
AF020781321noncereal_BlastN
SSCENT593noncereal_BlastN
ATCALBPM589noncereal_BlastN
TSCENTRIN572noncereal_BlastN
RATCAMPS566noncereal_BlastN
PCCENT543noncereal_BlastN
CRCABP536noncereal_BlastN
ATFCA1334noncereal_BlastN
ATFCA1320noncereal_BlastN
ATFCA183noncereal_BlastN
ATFCA1262noncereal_BlastN
HSU12475272noncereal_BlastN
HSU12475336noncereal_BlastN
NFU38787522noncereal_BlastN
U38788504noncereal_BlastN
KLAJ2021498noncereal_BlastN
KLAJ2021225noncereal_BlastN
HSU03270496noncereal_BlastN
MVU92973479noncereal_BlastN
PMCCALMOD467noncereal_BlastN
HS380C13466noncereal_BlastN
VCCALMODU462noncereal_BlastN
VCCALMODU282noncereal_BlastN
DSU53812461noncereal_BlastN
RSSC19430noncereal_BlastN
RSSC19158noncereal_BlastN
MUSCTNCA428noncereal_BlastN
AB008556419noncereal_BlastN
ACU67860417noncereal_BlastN
DDICALA400noncereal_BlastN
ATHACRP388noncereal_BlastN
ATHACRP373noncereal_BlastN
ATHACRP135noncereal_BlastN
ATHACRP162noncereal_BlastN
DNA
taagaaacaccagctttccattgatactagaagagtcaaacataagttga
tgaagaaatatactacaaacgggcccaactgcaatcaggatacaccaggg
aggggcaagttcacataaacacttgagaggtctggaaacacactggatag
aaggagcatagcacgaattgcgtcgtccgttttagcagctacagctagta
ggatgcttaactggaaatcgatcgaataagagttcagatcttaaactaat
atgcaatgcacagtctccggggcacgttcgatgctcatttggccatcatg
accttgacaaactcctcgtagttgatctggccatcaccatcaacatcagc
ttcacggatcatctcgtcgacctcctcgtcggttagcttctcgccaaggt
ttgtcatgacgtggcggagctcagcagcagagatgaagccattttggtcc
ttgtcgaacaccctgaaggcctccttgagctcttcctctgagtcagtgtc
cttcatcttgcgagccatcaggttgagaaactctgggaaatcaatggttc
cattgccatcagcatcgacttcgttgatcatgtcctggagctcagcctcc
gttgggttctgccccagtgaacgcatgaccgttcccagctccttggktgt
gatgcaaccatctctcgtgscggaattcctggcagcccggggg
BLAST
BLAST Search