Query (optional)   in Class  

GrainGenes Sequence Report: CDO650_WHE03A08.r1

[ Printable Version ]  [ Submit comment/correction ]

Sequence
CDO650_WHE03A08.r1
Probe
CDO650
DNA Homology
RICRPL3A724rice_BlastN
[ Show all 327 ]
DNA
cctggttcaaagctacacaagaaggagacctgtgaggctgtcaccattgt
tgagacaccaccaattgttattgttggacttgttgcctacgtgaagactc
ctcgtggccttcgtactcttaacactgtctgggctcagcatctcagtgaa
gacgttaggaggaggttctacaagaactggtgcaagagcaagaagaaggc
tttcacccangtntgctctcaagtatgacagttgatgcaggcaagaagga
aattcagcttgcagttgagaagatgaagaagtatggcactggttatccga
ggttatcgcccatacccagattangggnaatgatganngggcttggaagc
agnaagaagggctcacctgnattgggagtatcccaggttcaattggtggc
accatcngcagaccaanggtggncttatggctacaaatttctttgagaag
ggangtcccccattggangntggtnttcnannagggattngntggnttga
ncatcatcnt
BLAST
BLAST Search