Query (optional)   in Class  

GrainGenes Sequence Report: CJ648468

[ Printable Version ]  [ Submit comment/correction ]

Sequence
CJ648468
External Databases
Data at GenBank
Data at EMBL
Data at DDBJ
TIGR Gene Index
TC279751
NCBI UniGene
Ta.23826
DB Remark
Locus Source: Triticum aestivum (bread wheat)
UniGene title 'Histone deacetylase HDAC3'
Keyword
EST
Species
Triticum aestivum
Cultivar
kitaKEI1354
Clone Library
Y.Ogihara unpublished cDNA library Wh_EM
Tissue
dormant seed with water absorption
Data Source
genbankUpdated Nov 2006
Title
CJ648468 Y.Ogihara unpublished cDNA library Wh_EM Triticum aestivum cDNA clone whem13d03 5', mRNA sequence.
Clone
whem13d03
Probe
MAG1878
Remark
DB_xref: taxon:4565
Feature: source: mol_type = 'mRNA';
Locus Comment: Contact: Yasunari Ogihara; Graduate School of Agriculture; Kyoto Prefectural University; Shimogamo, Sakyo-ku, Kyoto 606-8522, Japan; Tel: 075-703-5675; Fax: 075-703-5675; Email: yogihara@kpu.ac.jp.
DNA
gatccgggccctcaagcgcttcaacgtcggcgaggactgccccgtcttcg
acggcctctacagcttctgccagacctacgcgggggcctccgtcggcggc
gccgtcaagctcaaccacggccttgacatcgccatcaactggtcgggggg
cctgcaccacgcgaagaagtgcgaggcctcagggttctgctacgtcaacg
acatcgtactcgccatactcgagctcctcaagcaccaccagcgagttctc
tatgtcgatattgatatccaccatggtgacggagttgaggaggcattcta
cacgacagacagggttatgacagtctcattccacaagtttggggattatt
tcccaggtacaggggatgtccgtna
BLAST
BLAST Search