Query (optional)   in Class  

GrainGenes Sequence Report: CK169480

Sequence
CK169480
Contig
Ta.30803.1.S1_at
Ta.30803.1.S1_x_at
External Databases
Data at GenBank
Data at EMBL
Data at DDBJ
NCBI UniGene
Ta.54141
DB Remark
Locus Source: Triticum aestivum (bread wheat)
UniGene title 'Transcribed locus, strongly similar to NP_200875.1 60S ribosomal protein L12 (RPL12C) [Arabidopsis thaliana]'
Keyword
EST
Species
Triticum aestivum
Cultivar
Wheat line CI 14106
Clone Library
Triticum aestivum FGAS: TaLt6
Data Source
genbankRelease 139, Dec 15 2003
genbankUpdated Nov 2006
Title
FGAS044111 Triticum aestivum FGAS: TaLt6 Triticum aestivum cDNA, mRNA sequence.
Strain
lab_host DH5 alpha
Remark
DB_xref: taxon:4565
Feature: source: mol_type = 'mRNA';
Locus Comment: Contact: Wm L Crosby; Bioinformatics; University of Saskatchewan, Department of Computer Science; 1C101 Engineering Building, 57 Campus Drive, Saskatoon,; Saskatchewan, S7N 5A9, Canada; Tel: 306 966 1769; Fax: 306 966 2033; Email: fgas_ests@cs.usask.ca; This sequence is the direct result of the Base calling software; Phred (default parameters). It is the raw base calls. To aid in the; identification of the high quality insert the software Lucy; (default parameters) has been run on this sequence. Lucy identified; the region [123,569].; Plate: TaLt605 row: N column: 03.
Note: Organ: Crown; Vector: pGEM-T; SSH (suppression subtractive hybridization) cDNA library from genotype CI14106 cold hardened at 2 C for 1 day (24 H)(tester) and subtracted against genotype CI14106 non-hardened (20 C) (driver). Nitro-pyrole anchored oligo-dT priming and non-directional cloning.
DNA
accagctcgtgagcatgattacgccacgctatttatgtgacactatagaa
tactcaagctatgcatccaacgcgtcgggagctctcccatatggtcgagc
tgcaggcggccgcactagtgattagcgtggtcgcggccgaggtccacaca
ctccccacagccaatcctccccagcccaagctcgcagccatgcctcccaa
gctcgacccgtcccagattgtggaggtgtatgtccgcgtcaccggcgggg
aggtcggcgctgcgtcgtccctggcccccaagatcggcccgctcggtctc
tccccaaagaagatcggagaagacatcgccaaggagacggccaaggactg
gaagggcctccgcgtcaccgtcaagctcaccgtgcagaatcgccaggcca
aggtgtccgtcgtcccctccgccgcagccctcgtcatcaaggcgctcaag
gagcccgagagggaccgcaagaaggtcaagaacatcaagcacagcggcaa
catcagcctcgacgacgtcatcgagatcgccaagatcatgaaggtccgct
ccatgggccaggagatggccggcaccgttcaggagatccttgggacctgc
gtcagcgtcggctgcaccgtcnacgggcgaggaccccaggatctgcaaac
cgggatcgacgacggcgaggtgggagatccccgcttaagaaggcttgggt
ttgggcaggtggtatgtgagggtgctgaaattagtcctcctaactgcatt
cttcctggatgagttgagaaaagggatgggatattttcattggtcctacc
cgggcctgaaaaagaaacttgggcagcgcttagggggtccattgggagag
aaatttttcacgggttcaatgaggtaccctggggaacaaaaaccctggcg
gggacccccctaacccgcgggcgtg
BLAST
BLAST Search