Query (optional)   in Class  

GrainGenes Sequence Report: CK780259

[ Printable Version ]  [ Submit comment/correction ]

Sequence
CK780259
External Databases
Data at GenBank
Data at EMBL
Data at DDBJ
DB Remark
Locus Source: Avena sativa (oat)
Keyword
EST
Species
Avena sativa
Cultivar
Ogle
Clone Library
UMN cDNA from oat
Tissue
endosperm
Developmental Stage
immature endosperm
Data Source
genbankRelease 141, Apr 15 2004
genbankDownloaded 2008-2009
Title
umn287 UMN cDNA from oat Avena sativa cDNA clone JMT4_F04 5', mRNA sequence.
Clone
JMT4_F04
Probe
UMN287
Remark
DB_xref: taxon:4498
Feature: source: mol_type = 'mRNA';
Feature: source: mol_type = 'mRNA'
Locus Comment: Contact: Rines, H.W.; USDA-ARS and University of Minnesota; 1991 Upper Buford Circle, 411 Borlaug Hall, St. Paul, MN 55108, USA; Tel: 612 625 5220; Fax: 612 625 1268; Email: rines001@umn.edu; Seq primer: T3.
Note: Vector: Bluescript SK-; Site_1: EcoRI; Site_2: XhoI; Oat cDNA library prescreened against seed storage proteins, globins, and avenins. Cloned into lambda unizap-XR cosmid vectors and converted into pBluescript plasmid. Note: UMN clones designated less than 5000 are from this cDNA library. Others are from a different oat genomic library. Library was made at University of Minnesota. Ref: O'Donoughue et al (1995) Genome 38: 368-380.
DNA
cttcttcttagctctccttgctctggtagtgagcgccacctttgcacaat
atgtagaatctgacggtagttatgaggaagtggagggtcctcatgatcga
tgccaacaacaccagatgaagctggactcttgtagagagtacgtggcgga
gcggtgcacaacgatgagggattttccgatcacctggccatggaaatggt
ggaagggtggttgcgaggaggtccggaatgagtgctgccaactgttgggc
cagatgccatcggagtgtcgttgtgatgcaatttggagatcaatccagca
cgagcttggtggcttcttcggaactcaacaaggtctgatagggaaaaggt
tgaagatagctaagagtttgcccactcagtgcaacatgggccctgagtgc
aatatccccgtgacttttggctattactggtgatgtagtttccaacagta
attgtcgcataccactaaatgtgacaataaatgtggtcatggaataatat
atgaataaaatttacccgtc
BLAST
BLAST Search