Query (optional)   in Class  

GrainGenes Sequence Report: CMWG645-5

[ Printable Version ]  [ Submit comment/correction ]

Sequence
CMWG645-5
Data Source
Kuenzel, Gottfried98.05.05
Probe
cMWG645
DNA Homology
AA9869622271noncereal_EST
[ Show all 649 ]
DNA
cgtcaccttgaagtacccgatcgagcatggtatcgtcagcaactgggacg
atatggagaagatctggcatcacactttctacaatgagctccgtgttgca
cctgaggagcacccagtattgctgactgaggcacccctgaaccccaaggc
taacagggagaagatgacacaaatcatgtttgagacctttaatgttccag
ccatgtatgtggccatccaggcagtgctttccctatatgctagtggacgc
acaacaggtatcgtgttggattctggtgatggtgtcagccatactgtgcc
aatctatgaaggatatgcccttccacatgccatccttcgtcttgacctcg
ctgggcgtgacctaactgactgtttgatgaagattcttacggagagaggt
tactccttcaccacgactgccgaacgggaaattgtaagggatattaagga
gaagctcgcatatgtggctcttgactatgaacaagagctggaaaatgcca
agagcagctcctctgtggagaagagctatgagctgcctgatgggcaggtg
atcaccattggggcagagaggttccgttgccctgaggtccttttccagcc
atctttcattggtatggaagctgctggaatccatgagaccacctacaact
ctatcatgaagtgtgatgtggatatcaggaaggacctgtatggtaacatt
gtgctcagtggtgggtcaactatgttcccgggtattgctgaccgtatgag
caaggagatcactgcccttgcaccaagcagcatgaagatcaaggtggtgg
caccgcctgagaggaagtacagtgtctggattggagggtcgattcttgcc
tcacttagtaccttccaacagatgtggatctcgaagggtgagtacgatga
gtcaggtccagcgattgtccaccggaagtgcttctaagttgcgagttgtc
tgggtcttctgaatctattctggctgttcttttctcaagtccttgccatg
taagctactatgtttgagattgctgggattctgttgactgtattgccgga
ccg
BLAST
BLAST Search