Query (optional)   in Class  

GrainGenes Sequence Report: CMWG676-3

[ Printable Version ]  [ Submit comment/correction ]

Sequence
CMWG676-3
Data Source
Kuenzel, Gottfried98.05.05
Probe
cMWG676
DNA Homology
AI031632146noncereal_EST
[ Show all 40 ]
DNA
aaatcagctgctgctccaagatcgataattttgaaggtgcgagattcttc
tgaaaatatcacattttggggttttatgtccctgtgaacaatcccccgtc
gaatgaagtccatcaagggcaaacaagagttgtcccatcaccgtttggat
aatcttattctctctcgctattccctttggmammaaaaatcctttttttg
gaaccaatttccgagaatcttagtctcaacattgtaagggaactccttgc
tttgcatgagagcagaaagcgtgtcctcgccttcatagcgccaaataagc
cagtattcctcgcccttacctttggttttgctctcacgaaagccgtaaag
aaaatctgcgcagctgctagcgcatgccctcctgacgcgctcgttcatcc
aaatctcgacbgcgccatactcgktcgccttcttcacgaccacgtcacct
tgcttgtccgccactttggggtcagacagggacgccttgtcg
BLAST
BLAST Search