Query (optional)   in Class  

GrainGenes Sequence Report: CMWG716-5

[ Printable Version ]  [ Submit comment/correction ]

Sequence
CMWG716-5
Data Source
Kuenzel, Gottfried98.05.05
Probe
cMWG716
DNA Homology
C73151680rice_EST
[ Show all 1050 ]
DNA
cgggtccaccaaccttgactggtacaagggcccaaccctgcttgaggcgc
ttgaccagatcaacgagcccaagaggccctcagacaagcccctccgtctt
cccctccaggacgtttacaagattggtggcattggaactgtgcctgttgg
ccgtgttgagactaggtgtcatcaagcctggtatggttgtgacctttggt
cccactggtctgacaactgaggtcaagtccgttgagatgcaccatgagtc
tctcckgnnnnncttcccggtgacaacgtcggcttcaacgtcaagaacgt
tgctgtgaaggatctgaagcgtgggtttgttgcatccaactccaaggatg
accctgccaaggaggcagccaacttcacctcccaggtcatcatcattgaa
ccaccctggtcaga
BLAST
BLAST Search