Query (optional)   in Class  

GrainGenes Sequence Report: CMWG768-3

[ Printable Version ]  [ Submit comment/correction ]

Sequence
CMWG768-3
Data Source
Kuenzel, Gottfried98.05.05
Probe
cMWG768
DNA Homology
AA741022119noncereal_EST
[ Show all 31 ]
DNA
ggaggagatggagtggctggtgggcttggcggggcaggggaagctcagga
cggtggtggactcgaggttcccgctgagcagagcgcaggaggcctgggct
aagagcgtggaggggcatgccaccggcaagatcgttgtcgaaatcggagg
cacagagtgaacatcaaccattgtacactacagtatgatgcagcaattgg
attgttcgtgtatgtgtggtaatttgagaaatcaatcaagaaatagcaat
aatgtgggggca
BLAST
BLAST Search