Query (optional)   in Class  

GrainGenes Sequence Report: CMWG768-5

[ Printable Version ]  [ Submit comment/correction ]

Sequence
CMWG768-5
Data Source
Kuenzel, Gottfried98.05.05
Probe
cMWG768
DNA Homology
AA696634175noncereal_EST
[ Show all 82 ]
DNA
cgggtgaaacatgcagtgggcgatctagccggcgaggtggtggagctggg
cagcggcgtgaccaacttcaagccgggagacaaggtcatgtcaatcagct
tcccggtaagcaaggacaaggcattcaccgccacggtgctattctgtttc
tgacacgctcaagggccgttgcctttgcctatgcagggcggcggtgggct
cgccgagtacgcggtggccccggcgtcgctcacggtggcgaggccgccgg
aggtgtccgccgtcgacggcgcctgccttccggccgccgccagcagcgcg
ctgcagctgctcaagctcgccggggtcagcttcg
BLAST
BLAST Search