Query (optional)   in Class  

GrainGenes Sequence Report: CN180770

[ Printable Version ]  [ Submit comment/correction ]

Sequence
CN180770
External Databases
Data at GenBank
Data at EMBL
Data at DDBJ
DB Remark
Locus Source: Avena sativa (oat)
Keyword
EST
Species
Avena sativa
Clone Library
ITEC CDO Oat cDNA Library
Tissue
leaf
Data Source
genbankRelease 141, Apr 15 2004
genbankDownloaded 2008-2009
Title
As02_cdo1385_C ITEC CDO Oat cDNA Library Avena sativa cDNA clone As02_cdo1385, mRNA sequence.
Clone
As02_cdo1385
Probe
CDO1385
Remark
DB_xref: taxon:4498
Feature: source: mol_type = 'mRNA';
Feature: source: mol_type = 'mRNA'
Locus Comment: Contact: Stephen J. Molnar; Eastern Cereal and Oilseed Research Centre; Agriculture and Agri-food Canada; 960 Carling Avenue, Bldg. 20, Ottawa, Ontario, K1A 0C6, Canada; Tel: (613) 759-1687; Fax: (613) 759-1701; Email: molnarsj@agr.gc.ca.
Note: Vector: pBluescriptSK(-); This probe has been used for mapping studies for species of the Triticeae and is available from the GrainGenes Probe Repository ( http:
DNA
cgagggcattcggcaaagaagggccactccggacagtgaaattacgtggg
aggaatataagtccatgaaatttacatcccatgtatatatttctgtcttt
gttcatcctaactagttagtgctcggttaaattatacactactttaatat
gttttcatctgatttttatctaggttattcatgaggcgttgaggctggct
agcattgcacccgtaatgtttagaagagccatagaggatgtccagataaa
aggtattagtagagacagcctgatgcatacagataatgtggtgacatata
tgttgaaaagtggccattactactgtgctaaattgtgtcttatttcatgg
ttgtttaataaggttacactatcccgaaaggatcaaagatcatgattagt
cccgccgctactcacctgaatccaaagatttacgaggaccctcatgtatt
caacccctggaggtggcaggtcagttaacatgttaagaaaatttatcatg
gacatgttacaaaacaaacatattgctcgacacatacacttattttatca
gcaaaaaagggtgcaatgaaagaaacaataatattacttatcagattctc
ataagtatgtagtacatatgcttgtttaataatactagttgaagtttgca
actttatttgcgcatgttttataactcaaaatattacacatgcttgtata
cagaattctgcagaaccggttggcagcgcctcgaaagatttcatggcttt
tggaggaggggtgcggttatgtgttggcgctgatttgtctaagctgcaaa
tgtcaatatttctccattgcttagttactaaatacaggttaccttcttgt
acttgaggtacctaaacagttacattctatagtatcaggcatatactgaa
acttatgcmtactgcaggtggaaaactatcaagggaggcmgcatggtgct
ttctcctggattgcgatttccagatggttttcacatcccscttctccaaa
aaggktggggggggggsgggataaaactgstttagggraagcmngbcccg
csktgctgcttttttttttkgktntgtaagaawcaaaamttaagramaag
ktcmgragrcmctwtgsgsgaatgwaaaaaattktaaccskctttatggk
tccctcccnaccccngsaagtttkttaaawmaaagawttggccmgktgrt
cgtttktgctamtttawaaaaaamaaraargaaaawcsstttr
BLAST
BLAST Search