Query (optional)   in Class  

GrainGenes Sequence Report: CN180784

[ Printable Version ]  [ Submit comment/correction ]

Sequence
CN180784
External Databases
Data at GenBank
Data at EMBL
Data at DDBJ
TIGR Gene Index
TC350755
DB Remark
Locus Source: Triticum aestivum (bread wheat)
Keyword
EST
Species
Triticum aestivum
Cultivar
Chinese Spring
Clone Library
Genomic clones from wheat
Tissue
etiolated leaf
Data Source
genbankRelease 141, Apr 15 2004
genbankDownloaded 2008-2009
genbankUpdated Nov 2006
Title
Ta05_wg420_C Genomic clones from wheat Triticum aestivum cDNA clone Ta05_wg420, mRNA sequence.
Clone
Ta05_wg420
Probe
WG420
MAG448
MAG1586
Remark
DB_xref: taxon:4565
Feature: source: mol_type = 'mRNA';
Feature: source: mol_type = 'mRNA'
Locus Comment: Contact: Stephen J. Molnar; Eastern Cereal and Oilseed Research Centre; Agriculture and Agri-food Canada; 960 Carling Avenue, Bldg. 20, Ottawa, Ontario, K1A 0C6, Canada; Tel: (613) 759-1687; Fax: (613) 759-1701; Email: molnarsj@agr.gc.ca.
Note: Vector: pGEM-4Z; Site_1: PstI; Site_2: PstI; A pGEM-4Z (amp resistant) cDNA library was constructed from mRNA extracted from etiolated leaf tissue of the wheat cultivar 'Chinese Spring' as described in Heun et al. (1991) Genome 34:437-447. For insert amplification, Use M13 forward and reverse primers. Clones from this library are designated with the prefix 'WG'.
DNA
agacaagcttgcatgcctgcagctcctccgataggagtaattggtcggga
taacgatcgtgacaagataatcgcaatgcttcatgagaaggaagaccatt
gtcaagcaaataatgtcagtgatacatgctattctgtaatcggcatccat
ggcatggctgggtcagggaaatcaacacttgcacagtatgtctatgatca
cgagaaaaagcgtaggcaagagaaaaaggagggccatttcaatattgtca
tatggattcatgtttctcagaaatttgatttggattccatttttagggag
atgtttgagggggctacagggaaagcatgcgataaattcaatagtcctaa
cgtcctgaaggaaaaactggaggatgaactgcgtgggaaacagattttac
tggtactagatgatgtctggtacaacagtaggaattcgggagaccgtgaa
gagctacaaaagttaatttctcctctgaatgttggaaaggaaggaagcag
aatcttggtgacaagtcgaactgaagctgcactagtatctctgggtgctg
taaaagagagatgtattccaatatctgacttggatgatgaagtgtttctt
gaaatgttcatgcattatgcacttagggatgcaagggtaagtgaccatga
taaaagaatacttgaattgattggagaggacattgcaaaaaagctgaagg
gctcacctctagcagccagaacagtgggttcacggcttcgtgaaacacaa
actgttgagttttggagaagccagaaagattgggaccttatgaatgacat
gatgggagctctatggtggagttaccagtgtcttgatgagtaggtcaggc
gatgcttcgcttactgcaggtcgactctagaggatccccgggtaccgagc
tcgaattc
BLAST
BLAST Search