Query (optional)   in Class  

GrainGenes Sequence Report: CR626929

[ Printable Version ]  [ Submit comment/correction ]

Sequence
CR626929
Subsequence
CR626929_1.cds13191
[ Show all 6 ]
External Databases
Data at GenBank
Data at EMBL
Data at DDBJ
TIGR Gene Index
TC277179
[ Show all 8 ]
DB Remark
Locus Source: Triticum aestivum (bread wheat)
Species
Triticum aestivum
Chromosome
5A
Data Source
genbankRelease 145, Dec 15 2004
genbankDownloaded 2008-2009
Title
Triticum aestivum.
Clone
213F23
Gene
542K11_1.1
[ Show all 7 ]
Remark
DB_xref: taxon:4565
[ Show all 51 ]
EMBL Feature
misc_feature89839258Fragmented and putative polyprotein sequenceLocation: complement(8983..9258)
[ Show all 21 ]
DNA
tcacttgcactgccgcgggtggaacttctcgtctgacaggagcgacgtga
cgagccgctggagccgcacggccccacggccaggctgaagaaagctggtg
ttcccgacgaccgagcaggggtcgctcccgttgtcccctgtccccgcgca
ccagcctccgggcgtgggcgcgtccgggccggcgtggcgggacaggagct
ccgcgtcgatccggtcgagcacgggctcgtccgcgtggaacttgcgggcg
aagggcgcgtcgctggcgatcatacgatccaggtcgtccatcgtgaggta
gtgtgggtgctgcttcggggggttgtcccacgagatgtagtgcaggtcgt
ggttcaccgtcgtgttcttgaactcctccgcgttgcagacaacggtgtgg
aagtagccctctggggaggagatgaagttggagtagtacatgaggacggt
gcggggaaggttgtcccagccccatatgctgtactcgaccagcgacctgg
acagcgccatccaggctgaacctgcatcaggatagatagggattatcaga
tgcatctacaaacatatcagagatttaagagcaaagattggttcctcaaa
aaggcccagagtaacagagttaattggtcactcaaaagctcttgaaatgc
aatatttgtggggtttgtgacgaagagcaagatgctgccatatttccttg
ttagttattattacacaggaaagctaaaatactatcattggcctaatcat
gctgctaatgttttgcttgccagttaggaatcaaatgccttgaacttcac
tgcaaaggcaggctctgaatcttacagctacttatctggttgagatgttg
aaacatggagtgtacacatcaggtcaagaactacttgaggaactgagatt
agatcagtcttcttggtctagagagaggcagaaaggtgatttttttgggg
gctactagtaagaacatttacaacaggtgaagtttaccagcacaataaag
taactgaactgaaacagaaacagaaggttttgctagttacattcaataga
tggaatggaagtttcctcaaggagtttcaacaggaaaggtaaatctgaac
acaaggagtttcctcatttatgccacgtttgttttcagcaaaagaaacaa
aaaaaaaagcaactattaagctagaaaagcaccacatttattgtgctgga
ttctgcatgatatctcaggaaatagtaataaaatagtaacattggcctaa
tcatgctaatgttttgcttgccagttagccttgaccttgactggaaaggc
aagctctgaatctggaagctacttatcagattgagatgttgaaacatggg
gtgtgcatatcaagttgagaactactccctccgttccaaaatagatgacc
caactttgtactaaagttagtacttgagaaactcggatcagttgatcttc
ttggtctagagagaagcagaaaggtgaaattatggggctgctaataagag
catttataacagatggagtttactagcacaataaagtaactgaactggaa
ctgaaacagaaactgaaggttatactagttatattcagtagacagaatgg
aattgctgtcacgcaggaaagataaatctgaactcatggagtttttccat
ttatgatttgtttgttttcagcaaaaaaacaaaaaacaggcaactaaact
agaaaagcatcccatttattacgcagggttctgcatgatatatctggaaa
ccctttgaagatctttttatggtaatataaatcgatgagaactgctacac
acacgatgggttgtgcccgatttgtagacgacaagctgtatcagccatcg
atcacttgggttcacctgggccgcagccaacgatcacaacgtcgtcttaa
aatcgtccagcaacttatcgtgtgcatagtaatttcgtaaatcgatttca
gttggtggcgtgctcaccagaacttgcttgatcaaacacgtatcaaagag
aatatatagtttcaaatcctgaacactcacattcactgataaactcttct
actccctccgttcacttgtgtaaggcgttttagacacttaagacgacacc
caaaacagttcaattttagctgtcttaaaaatcttacaaaagtgaacaga
gggagtacaacaaattctttcaattgacggaaagaatttgcaggagtcta
gtatatatgcacagtgaatataatgccctttgttattaccggtgaagagc
ttgaaggctgttggcacgctccggcgctgtggtatccagaacacgtcagc
cttcttcttcatgtagagccctgggtcgatgatgaccggcttcgccctct
gaaacctacaaagattaacaaaccaacaagaagtgcattaatttcccaca
gtgtccatccatccagccacggtgcaccatcgaccgatcggagttttaag
ctgggaaggaaggaaagtcctactccttccatccgatgttgctggtgtgg
tcgatgaagttgagatcgcgcggcagcttggagaagacatggatcagatc
tgcagcaagcaagctcacagggtcagattagtggatttgaacttggaaga
agtggtggaaggagaggtcaaattaccgtcctgcgtgacgagcgggtagt
cggaggcggagaggttgatgaaccagtcccagtcggacccgccggcgccg
gagtggccccagaggagggccgcggcggcgtgcagggtgctggcgaccat
ggtgggcccgcggtaggtgacgaggttggcccgctcgacgacgcggacgt
tgccggcggcggctatgacggggtgcgccgcgaggccggcggcgaggtcc
cggcggtcggactccggcgcctccgcatctaggtgcaggacgtagaggtt
cctggggtggtagagcgcgaggaggacgcggcggagcgcggaggcgtcct
tggcggatccggagatgacgtaggcgatgcgggggagggatccggcggcg
cgggaggccggcggggtcggggcgagcttgtgctcgacgaagagcgccgg
ggagggcgaggaggaggggaagaaggggaaagggacggtggtgaggagga
cgaggaggaagagcgacagcgcggagccgacggccagagggagcagccac
cggcggtccacggcggcggcgtggacgacgatgggcttcatcggcggcgg
cgggaggaggcagccgcagcggcggcttggcaggaaaaaaggccggattt
tggcaggtgaacggcggtaaccactaaaaccgggtttaataatctactgt
gatataaaaccaggtttatacaaacacttcaatgatcaaatttgagttct
ttgtgagcttaccttccacaaatgttgttagttaattcgatttcaattgt
tcatttgggtgcttagggggataacatgttctgctttttccttggcttaa
tcaacattttttaacacagcacaaacatagacactcatacatatttcaca
agaaaaaagacactcatacatacacacatacgacttgtataggatctgac
ctttaggtgagaatcgtaggatcaacaccaaaatttcatgtttagacatt
ttaaaaaattctgaatttttgaaaacatacctgcaaagtatgtttacaac
tctaaaaaaatcagcttcaaacccggtctatagtaagagattcaataaag
acaaattcgactatgaatagtgtcatcttggggtgaatagcatttgacaa
tattcacatccgattttctcttttttggttctctaagtgtactctgaatt
aggagttgaaacctcttgaggttgtacatcaaacatggatgtgtgtttat
aactatttttagaaattttgaacatgttttgagtctttaaatagattgat
ctatttgatctcacctaaaggtagatctcatacaagtctcgccctcacac
gccaccccccccccccccccgcgcacacacacacgcacactccacccctt
acaagcaccttcgagaaactgagtcgacacatcatcttgagattgatgaa
gtcgccacaaatgccttcatagtcgacgggaacgtctcctcccactgaac
gcacatcgccggaaagcttgaaataaatccagaaaaagctcaagttcagg
acttgaaccctggtgggctggggatatcactgtcctcctagccatccaat
cataggttagtttgcatcaacacttaaccttgattctaacaatttgggta
tcaatgaatttttttttgtcatggtattttccttatcaatgtctaaaaca
cgacttagtatgaattcagtgaagttaacagatttatctataatctgtgg
gttgggtttagtccttgttgtacaattttttcatttctttatcaaatata
ttaaaacgagttgcatccatcctaataacccgcacaacaatacaattgca
gttccacaaaacaattaaaaaccataacaaatattaggcgcgagccacgt
agtttcgtatgcattacagagtgaaaccatggggagaagaggacaacatc
ttggtgagtcattgcttatcatgtactaataacacataagacacatgctc
taacaattttttggtgaaagctaagaatggtggatccatctgaaacaacc
tacggaagtccacaagttagcgttcatgaaagagtaaactataaaacact
taaccatatgttttttagtacaatacaataccaaaagcaggacatggaag
tgtcacacatcattactcattgtatgtttccacaaaagagtagatacttt
atgaaaaatgccatctatataattaccacacaatggctaatacatgacag
aacaaagaaagttagtggaagatgacatctagatgcattacttatcatgt
tctactaccttgtataacacaatcactagcaacatggtctcgatctttct
ttaaagacccgcacaattacaaattaagttccacaaaaaaccaaagtaag
aagccttggaataacattacatgtggtctctttcgaggaaaattgcagat
tcagtgcacgaaacatcatctcaacaacttgctaaaattatgtgtgcttg
caaagtaactttggtcatccaactaaatttgtaagcattcaaaagcaaca
cagaatggtagacatatatcatgtcacatcatccattataaatagtggcc
tcatctcatctttcatcttcaccactaccaaaacaacattgacaacatga
agatcttcttcctcctagctttccttgctctggtagtgaacactgctatt
gcgcaatatgcggaagttcccagcccagctgcgcgagctcccaccgcgga
tggttctggggaatgggttgcgatagcacctagtgcgagtggttctgaga
attgcgaggaagagcagccaaagctagactcttgcagcgattatgttatg
gatcggtgtgtgacgaaggatatgccgctctcttgggtctttcctcagac
ttgggggaagagaagttgtgaggaggtccaaaaccagtgttgtcagcaat
tgaggcaaacgacgccgcgttgccgctgcaaggctatatggacatcaatc
caaggcgatctaagtggcttcaagggccttcaacaaggtctggaagccaa
aatggtgcagacggccaagagccttccctccaagtgcaacattgatccaa
aatactgcaacatccccatcactagtggatattactggtgatgtagcttc
cactggtgaccaataaactatcacataccactgtatgtgaccaataaatg
tgaccatggaataatatgtactttagttttccttacttatgtatgtatgt
gtttctcttacaaacatctaattatgcatgtgtctatcaagaaaacaatg
ttaattgtgccagtacaaaaggaatgtgtggaagcgcaaatacgcctctc
attgcgttttggtatacatggcgaaaaaattaaatgggataattagggca
tacttgtgaacagattttagtcccaaccatgaaggttgtcgagaatcaaa
gaaccattaaaaatggaaataacacaaaaatgtgcctcggtagaggttat
tttataggctttactcacaacggttgggagggggtctcctattgagacct
cctcttcttcggcgccttaagcgcccgttcccatagcgggcgctcgcgca
gcagcctcgggtgggccgacccagcaagcacgctcacaccttccttttct
tccttctatcgctagctccttcatgcacgtttctttcgtttttctttttg
ctgttcgtccctttcgttcacaaaaactgaaaaccacatggatctgaaaa
ttaaaaatttgaaaagcagttcacgaatttgaaaaagttcatcaattttg
aaagcaaaaaaaagaaaaagttcatcggatttgaatttttttgctgaatt
tgaaaagaagttcatcaaaattgagaaaagttcactgaattcaaaaaaag
ttcatcaactttgaataaaagttcatcaaaaatgtgaaaagttcactgaa
tttgaaaaaagttcatcgactttgaataaaagttcatcgatttaaaaaaa
agttcatcaaatttgagaaaaagtgcatcaattttgcaaaaggattcggc
gcctttgaaaaagttcacgcatttatgagaaaagaaaaaacaagatagaa
aaaaaagaaaacagaaaaaataattggctttctcatattgtataaagaaa
agaaaaaagaatagtaagcacatcatgtcttctgatctaactggttagag
catctccagccgtgaccccaacagacccccacgcccctttttaggtgccg
gcacccagaagacggtccagtcggacccccatgagaacccattttttgcc
ggttaggcccaaaactggcgtcggcggacccaacccaaactcggcacgct
ggggcgccgggggtgccgaggcaatcgtttttggcgccaaagaacggtgg
gcccgccgagtcaacgaccctcgcgcctcgtcgtcctcacatcgcctcgg
tttcccgtggggaatcaatgccaaggctgtcgccagtcagccttccattg
attcctcatgagtggtgcggtgaggcgacgcgccccctcccgccacgcgt
acacatgattgccgcctccggccgttatataaagcagcacctccctcgcc
ggtggacacacccatgatgggtttcgtagtaatttcaaaaaaattcctac
gcacacgcaagatcatgtgatgcatagcaacgagaggggagagtgttgtc
tacgtacccaacgcagaccgactgcggaagcgctgacacaacatagagga
agtagtcgtacgtcttcacgatccaaccgatcaagcaccgaaactacggc
acctccgagttcgagcacacgttcagctcgatgacgatccccggactccg
atccagcaaagtgtcggggaagagttccatcagcacgacggcgtggtgac
gatcttgatgcactacagcagcagggcttcgcctaaactccgctacagta
ttatcgaggactatggtggctgggggcaccgcacacggctaaggaataga
tcacgtggatcaacttgtgtgtttctggggtgcctctgcctcagtatata
aaggagccaagggggaggggggcgccggccaggaggagggcgcaggagga
gtcctactccttccgggagtaggactccccccccccaatcctagttggac
taggattccccgagggggaaagagggagaggggggccggccacctttcct
agtcctaataggactaggggaggggggaggcacgcagccaccttgggctg
cccctttctcctttccactaaagcccattaaggcccatatggcttccggg
ggattccggtaacctcccggtactccggtaaaatcccgatttcacccgga
acacttccgatgtccaaatataggcttccaatatatcaatctttatgtct
cgaccattttgagactcctcgtcatgtccgtgatcacatccgggactctg
aacaaccttcggtacatcaaaatgcataaactcataatataactgtcatc
gtaaccttaagcgtgcggaccctacgggttcgagaacaatgtagacatga
ccgagacacgtctccggtcaataaccaatagcgggacctggatgcccata
ttggctcctacatattctacgaagatctttatcggtcagaccgcataaca
acatacgttgttccctttgtcatcggtatgttacttgcccgagattcgat
cgtcggtatccaatacctagttcaatctcgttaccggcaagtctctttac
tcgttctgtaatacatcatcccgcaactaactcattagttgcaatgcttg
caaggcttatgtgatgtgcattaccgagagggcccagagatacctctctg
acaatcggagtgacaaatcctaatctcgaaatacgccaacccaacatcta
cctttggagacacctgtaatgctcctttataatcacccagttacgttgtg
acgtttagtagcacccaaagtgttcctccggcaaacgggagttgcataat
ctcatagttataggaacatgtataagtcatgaagaaagcaatagcaacat
attaaacgatcgggtgctaagctaatggaatgggtcatgtcaatcagatc
attcaactaatgatgtgacctcgttaatcaaataacaactcattgttcat
ggttaggaaacataatcatctttgattaacgagctagtcaagtagaggca
tactagtgacactttgtttgtctatgtagtcacacatgtattatgtttcc
ggttaatacaattctagcatgaataataaacatttatcatgattataagg
aaataaataataactttattattgcctctagggcatatttccttcagtct
cccacttgcactagagtcaataatctagattacaccgtaatgattctaac
acccatggagccttggtgctgatcatgttttgctcgtggtagaggcttag
tcaacgggtctgcaacattcagatccgtatgtatcttgcaaatctctatg
tctcccacctggactagatcccggatggaattgaagcgtctcttgatgtg
cttggttctcttgtgaaatctggattcctttgccaaggcaattgcaccag
tattgtcacaaaagattttcattggacccgatgcactaggtatgctaccg
gcctccgcattgtgcctggcgagcttgcgcagcggtgtcccaccatgggc
atcatgcccgcaagcagcaccggccatggggaggaggaaaacgaaaaagg
agaggcaagatttgacgccgaaggccgggatagctagcggcggagggata
gggtttggtaaccctaaatcctggctaaaccgtagatatagcaccggaga
gacgttttcgcgggccgcctgtaaatttttatgggccgtgctagatttag
cggatctattcggacaaaaaaacgtttaatctcacaaaatgaccggagtt
ttacgggccggcgtgcttttgcgcaatctgctagagatgctatgatccat
tctttttggaaaaaaatgtaggtagcaaaagatcacctatataccacagt
ccacggtgagtagccaataaatagagtgctgaaataataatatatgaaaa
gattatcatatgtatgtttcttggtacaaatatgcagccaaaaacagaag
agaacgtgcgtctttatctcaactagtaaaatgcccgtgcgttgctacgg
gcaaaagccgaatgtccgtgcattgccacatatttataaaaatatagaaa
cattgatcaaattatccttttaattcaaaaatatgtttttaagcaaggtg
gcatatgatttccatcatatagcgacaaataaagactctcttccacttgt
ttccttcttggtagtctttgtgtctccttaaccaaccaaatcattcgcta
actggatatatgttgcccacgattaaatagcattagtatcactcaacttc
acgcatccatggtgtcattattataaggtacacaaagcttggcaattcct
tagacttatagtgcgcctcttaatttcagcaataatagcacgagaagaaa
gatccaattttgtgagattgttctttatcaatagcatagatgttccattc
tccatagcaataaccagtctgaaaataacactgcaaatggtttgagcttg
tgtcaaatattaggcccaagttgttaactgcgtcatttttcaaccaaaca
catctcccttgttggtaagtctatagggcaccagggcttgtactgcacct
ggattcagcttgtacatacaaatgttttcaaaaaaatctgagaaaaagtc
tacagatgggcacaacatgaaccgataatatcacaaaaatcaagtacctt
ttgaatctcaactaatgtcaaggtccaaaaacaaaagtagtattgacagt
ggtaatgggcaaaatttaaagcccaactgatgttgtgtactatcagagtc
aaatttgtctttttctcccgaactatattataaattatacttcaaatttg
tgacacgggtgttccctcttgcaggttgaatttatgttggaactatttta
tttcaaaatttaattggattataatatttatagtagaactactgtcgcat
ttgaatattctcattcatgaagatttgatatgctattattttgatccgtg
tccgtgaaccaatccgcagataaatagtgtgtccattttgtgggcccgca
ttgaaggtgcctttaaggcctatcttgccgacacagtggtcgtggtcatg
acagcaggcgtcaagccgtcaaggtcttcacaacgccacaactatccttc
cctgtctccaccaagttcataggtagtgcaacggcggcggacccgtgcgt
tgccacgaaacaacacatttacgcacagtgacatgtttttagcaagtaat
attaaagatatcaaacaaacatgaaagctgctccaataatcacttatcat
gttaatgtgagtagaaataacaaataacaatgttgagatagacaatttaa
caaagaaaaaggacaccaaccccttcttacgtccgtaattcaagaataaa
cggtccttttcaagggtttgttatgctctcatcaagaatatcgttttcga
ctttaaaaagagtttgaattttatatacagtgcagctctattaaaagtgc
aagaataagcggggccttttcaggcttttgttaggttctcaatttcacac
ggattcgcacattcgataattacaatcttataaaaattgcaatttagtag
gagtacttccaagggtagaggggtttgagttcttttgccagcttgccttt
tgattgaatactccttgagctccattatcttgctcttgtccacatgtcca
catgacacaagcaaaatcatagctagaagacgacaacttggcttggatcc
atgctaagaaatactcccttcgtccgaaaatacttgtcatcaaaataaat
ataagaggatgtatttaaacatattttagttctaaatacatttattttta
tccattttgatgacaagtattttcggacggagggagtatattgtttgata
atcatgctcaaattaaaaaagtcaccctctcctagaaaaagaaaaaacat
tctccatttctcacaattgctatggcttcttctcggtgggcccacgctgt
cagtgacacacggcggctagtgggtgtcacgtagctcacgtggcagcgca
aagagaggtccttgaagccaccgagctaaaaaagacattcttttccacct
cttctgttccggcaggggcggcggcgatggcggccaggacgcggtggtcg
gcgctggcggcgagcgctctgatccagtgcttcgcggggggcagctactg
cttcggcgtctactcgccggcgctcaaggcgtcgcagggctacgaccagt
ccgcgctcgacgccgtcgccttcttcaaggacgtcggcgccaacgtcggg
gtcctctcgggcctcctcgccgcgtgggcgcccgcgggagggcgccgacg
cccctgggtcgtcctcctcaccggcgccgctctctgcgccgcagggtacc
tccccatgtggctcgccgtcgcgggtgtcgtgcccgccccgctcccgctc
gtctgcctctacatgctgctcgccgcgcaggcgcagaccttcatgaacac
ggccgatgtcgtcaccgccgtcgagaacttccccgaccgccgcggcaccg
tcatcggcatcatgaaggtacctgctgccgatcgatccccttactctgct
ttcagtctctgctctgttcctctgcatcagtaatttgctctgtgagttac
aacaagaaaacaatccaaagaagcatgtgaaatccacaggctctgtctgc
tccaatcgtacaaaccaaaaagaggcatgtgaaaggatctgttttgttcc
atttttatgtgcagaaatctgttttggtggcataccacagtggcacagta
gtacagagatttatgctgaaagtagtcaaggagagtaattttgatgcaac
acaaccttatttagagacaaacagttctagagaagtacaattcatcgagc
acaaccattctgggaatccttgctccctgggaggcagcatcacaggttct
agaaaagtacagttgtgtaggtacaggaactgtttcataataatgttttc
tggtccagatacatcagagaggcaataatgcagtgttcattcgctggcct
cgtcctttacctaccacaccaggtggagctatcatttttgtcttaattgc
ccgaactttcagtgttattgtcttcagttcccgcctaactgtattcataa
ctctgatgatgtgaacttgtgtggatccaacattgcacacactttatttt
ctcaataatcccaacctacactctgtttcgcagtttatgacatcgattca
tctgtttaatttccaaacagggttttctaggcttgagcggcgcaatactg
gtccaagtacagcgcactctccatattgatcccggcagtttcatacttat
gctggcaatactacccacagccatcgcgttgctgctcatgtactttgtcg
acgtccacagcgctcatcagcggtacaacaagaagttcctcgatgctttc
tctctcatggccgttactgttgctgggttcctgatggttgtcataatctg
cgaccaagttttcatgataagttcagctgggcagagtgtttgcttcgcga
tactcttgctgctgatcatgtctccagtgactattgttgtaagggctcag
aggtccgaatcgaagcagcgagaagaaccaacgtcggaagaacaaactgg
tttacttcttcatgaggaaacggcgcagcaggattcagagaacgccagct
ctagcacaccgcttgtgggatctaataatcaggacatgtcgtcggacaaa
gcagagaacctgaacgtggtgcaggccatgtgcaaactcgacttctggct
gctcttccttgcgatggcctgcggaatgggctcggggttggccacggtga
acaacatcagccagatcgggggctctctgggctacacgagcagggagacc
agcactctggtgtccctatggagcatctggaacttctcagggaggttcgg
cgcaggctacgtctccgaccacttcctccggtcgcgaggactgggcaggc
ctttcttcatagcagcgacgcttctggtcatgggtgtaggccatgccatc
atctcctccggtttccacgcatcgctctacgtcggctcggtccttgtcgg
cttgtgctacgggtctcagtgggctttgatgccgagcataacttcagaga
tattcgggctaaaccattttggcaccatcttcaacacggtggccgtcgcg
agccctgttggctcttacatcctctcggtgcgcgtggtcgggttcattta
tgacaaggagtcaccgcaaggtgagcttgcctgtgccggtaagcactgct
tcgcactctccttcctgatcatggcatgcgtctgtgtcttcgggtctgcc
gtagcatttgtattgttcatcagaacaaggaagttttatagacgggtcat
atatgccagactgctcccttttgtagataaatgaggaaatgtatatatac
aaaccagttttcctgtatctttaatatagtagtaacaatatcatgttagc
atttggtattgtagcactctctttagatagcaacaatacaatggtcactt
cctgtgttaataagcaaatgaaaaagaaaccaatatttgtatttcagttg
agtgacacatatttatcgggaaaaaagctgagtgatacatactccctccg
taaagaaatatatgagcgtttagatcaccaaagtagtgatctaaatactc
ttatatttctttatagagggagtactttacaggagttgtgctcttacagc
aataccatgttagcattaggtattgtagcctccgtcccaaaataagtgtc
ttggttttagttcaaatttgaactaaaaccgcttcacttattttgggacg
gaggtattatatagcaacattataatggcaatttctctgagaagagaaat
caatattatttatttattttactccagttgagtgatacatattttatttg
aacaaacactgcatctgtttgtgtctgtaagggagcactagtttacatgt
tcactctgatcctgtaactctactcgtcaccttgattgatgtctccgttg
gctacctctgatgttttgtccttcccttcgtctttcttcgcctctccctc
ctttatctccttggctttcttcacttcagcctccttggcctcctcttcct
ccttcgcctttgccgctcctgcgtcctccttggcctgcttgagcgcctcg
atgagtcctgccaagcacacatcagggtccctccttttcttcttggacat
ggcatcaggttctccgccacatcagcaggcgacatatcgatttcctcgag
cagctgctggatctcgccgaacagctcatgctcaacgatgtccatgtagt
tcttggtgagcaccgtgaagccctcgaagcgacagtaggacatctctatg
tgcttgtccatcctgccccgccggatcagtgcggggtccagcttctcctt
gtgattggtcgtgaagatgataatccgctcacccccgcaggccgaccaca
gcccgtcgatgaagttgagcaggctagagagcgtcactcttctctggctc
cattgatagcttggatctgtcatcgtcatcagaatccttatcgccagagg
ccttcttgtccttgcggcgtttttcggtgaggtcggcggagcagtcgatg
tcttctatgacgatgatggatttgcctgttgtcgcaatgaagagcttccg
cagctcggtgttgttcttgacggcagtgagctcgagatcgtagacgtcgt
agtcaaggaagttggccatggcagcgatcatggtggacttgccggtgcca
ggcggtccataaaggaggtacccgcgcttccacgccttgccgacctttgc
atagtagtccttgctctcctggaacgccatgagatcgtcaacgatggcct
ccttctcatcagggtgcatggcgagcgtgtcgaaggtggcggggtgctcg
aaggcgacgtggctccagacgctcttgctgtggtaggggttccagttgcg
gctggcgttgttggtgaagagacggcgctggcggttcttgacggtgacgg
cacgaccctcgccgagcacgaagggcaggtaggagttgacgacgaggtcg
cggtggcgcctgtggaagacgaccttgtagaagcgccgctcgtcctcgcc
ggggtagaagctgatgacttgggccctggactgccgcttggaggcgtacc
accagatggtcgtgccggagaagtcgtcggtgacctcgtcgtggtcgtca
acggtgactcggaggttcttgctgtccttgccgagctcggccttgagcct
ccatgcatggcgagcataggcatcgctcacgtaggcctcgacagcgagaa
aaaattcgctacgctggaatcgcttggcgccgtactcggagatggtgatc
tcgtggtaagggttgaagttggcagcaatcttggctgcccgggtggtgag
gaagaggcggagggtgtcggggacgtggttctgcaccatggaccataaga
agatggcgctcgccaccgccgatccaaaccatggcaaccactccgccatg
ggcgctatggctggacctcttgatattgtgtcttgaggctttcttgttgg
aatgctataggtcgatctgcactggaagcgcctgcatatgtgtatatata
atgctggagagttgtgggtgatttacttaagttgacctgagtcttcgtgc
ccgtcttcgtttttgttgtcgtcatcggagcatgttcgactttgcctttg
tcgtcatcggatcagatttgtgttcttctttgccgttgtcggagcaggtg
aggaggagctgtcggagcagagaagaatctacagcatggaaaaatcctgt
ggattacctttgcccagtacgtttgagacaggggagaggttggcatttcg
tattgtagctattccatacatacacaggaattatcatcattattattctt
gttgagggatacatattttgttttgtgcccccatttgcctttctccttgg
cttcacactctccttcatgatcatggtgtgtgtcgtaccgctcgtattgt
tcgtcgggacgagcatgttctataggcaggttatatacgccagaatgctg
tcttttgtagtgaagtgaggaaaatgttcgctgtgtacttgcaacagtat
catgttagaattatgcatctggtatcagttatattaactttctaaaggta
acttcccgtgtgaattaaccattgagaagagaaagcaaaaccattttatt
ccagctgagtgatacataatttatttgaacaaacactatacatccttttt
gttgttgtaagcgagcactagtgagcaagcaaacttgtttgatgtcttgg
ttggctacctggcttcctggcacgttttttctttcatttgtcttccttgg
gttcctctttctccttggctttctttgcttctgcctcctcttcctccttc
gcctttgccgctgccgcagcctcgacggcgtctttcttggcctgtttgag
cgccgcaatgaggcctgccaagcacatgttcgggtccttctttttcttct
ttgacacgggcatcaggttctctgccacgtcggctggtgacatgtcggtc
tcttcgagtagctgctggatctcgccaaacaacacatgctcgacgatgtc
taggtagtttttggcgagcaccttgaagccctcgaagcggcaataggaca
tctcgatgtgcttgtccatcctaccccgccggattagcgccgggtccagc
ttctccttatggttggtggtgaagatgatgatccgctcaccgccgcttgc
cgaccatagcccgtcgatgaagttgagtaggcctgagagtgtcaccttgc
tttcatcgtccttctgtggctccgtcgggtccgcttcatattcattgtca
gagtccttgttactcgaggccttcttgcccttgcggcgcttaccagtgag
gtcaatggagcaatcgatgtcctcgatgacgatgatggacttgcttgtca
tctcgatgaagagctttcgcagctcggtattgttcttgaccgacgtaagc
tcgaggtcgtagacgtcgtaatcaaggaaattggccatggcggcgatcat
tgtggacttgccggtgccgggcgggccgtacaataggtacccccgcttcc
atgccttgccgacctttgtgtagtactccttgccatccttgaacgcaatg
aggtcgtccatgatggcctccttttggtcagtgtccatggcaagcgtgtc
gaacgtggccgggtgttcaaacttaacatagtcccagacgctattgcgaa
ggtagcgcctccgtctaccaccgcagttggtgaagaggcggcgctggcgg
ttcttgacgatgacggtgcggccctcggcgaggacgaagggcaagtagga
gccgacgacgaggtcacggtggctcctgtggaagacgacctggtagaagc
gtctctcgtcctcgccagggtagaagctgatgacattccccttggaatgc
ttcttggaggcataccaccagagagtcacaccagagaactcatcggtgac
ctcctcatggtcgtccacggagacctgcaggttactgctgtcgctcccga
gctcggccttgagcctgcgggcgcggctggcgcacgcgtcgctgaggtag
gcctcgacggcgtagaagaactcgctttgctgaaagcgcccggcgctgtt
ctccaagatggtgatctggaggtatgggctgaagcaggcggcgagcttgg
cggcccaggtggtgaggtagaggcggagggtgaccgggacgtggttctgc
accatggaccagaggaagatgatgctggccatggccgaccccaaccccgc
ccatctctccaccatcgccaccatggctggctagctctcttcttgctaat
gtaacgctggagatttgtgtgtgtagtgtatatatagttcctgagttctg
ggtgctgatttacttaagtagacttaggggcgaccggtggtcgttgtggt
cgtcggagctggtgaagatgagctatcaaagccgggtaacttcatgcgcg
catggaaaaaatgcagaacttggtcgaccggtggtcgttgtggtcgtcgg
agcaggtgaagatgagctatcaaagccgggtaacctcatgcgcgcatgga
aaaaaatgcagaacttggttgcttccggatttgggttgcttaatcaatta
attaatgaaggagcagggtaggttccgattgctaattgcgtattctgtca
ctgtcatgcgtagtgtcgatattgtgttggtgaaattgtagggaagcttc
ttatgccacgtttaggtttaactccctatagaaaaactggttagcatttt
gttgtaggtaaagcgaatgggtcttgttagcattttgtatagttttgccg
gaaatattacaaatgagagatgaaacaattatctatataagtaagggggc
acatattacaaatgagagatgcaacacacaatatctcagttgagagctta
tattttctgtgaacaaacactgcattttctttttgtacaagcgggcacta
gtgaacaagctcattcttttttccttggctttctttcttgatttcacttt
actttgtcaccttccttgatgtctccattggcttcctctgctgctttgtc
cttccctttgttttcctccttggctttcttcaccgccgcctcttctttct
ccttggctatctttgctttagcctccttggcctcttcttcctcctccgcc
ttggccgctgctgccgccgcatcttccttggcctgcttgagtgccttgac
gaggcccgacaaacacaaatcagggtccctctttttcttcttcgacattg
gcatcaggttctctgcaacgtcggcgggtgacatgtcggtctcctcgagc
agccgctgaatttccccaaacagctcatgctcgatgacatctaagtagtt
cttggcgagcaccttgaagccctcgaagtggcagtatgacatctcgatgt
gcttgtccatccttcctcgacggatcatccttgtcactagaggccttctt
gtccttgcggcgttttccggtgaggtcgatcgagcagtcgatgtcctcta
tgactatgatggacttgcccgtggtctcaatgaagagcttccgcagctcg
gtgttgttcttgacggcagtgagctcgagatcgtagacgtcgtagtcaag
gaagttggccatggcagcgatcatggtggacttgccggtgccaggcggtc
cataaaggaggtacccgcgcttccacgccttgccgacctttgcatagtag
tccttgctctcctggaacgccatgagatcgtcaacgatggcctccttctc
atcagggtgcatggcgagcgtgtcgaaggtggcggggtgctcgaaggcga
cgtggctccagacgctcttgctgtggtaggggttccagttgcggctggcg
ttgttggtgaagagacggcgctggcggttcttgacggtgacggcacgacc
ctcgccgagcacgaagggcaggtaggagttgacgacgaggtcgcggtggc
gcctgtggaagacgaccttgtagaagcgccgctcgtcctcgccggggtag
aagctgatgacttgggccctggactgccgcttggaggcgtaccaccagat
ggtcgtgccggagaagtcgtcggtgacctcgtcgtggtcgtcaacggtga
ctcggaggttcttgctgtccttgccgagctcggccttgagcttgcgtgcg
cggcgggcgcacgcatcgctgaggtaggcctcgacggcgaggaagaagtc
gctgcgctggaagcgctcggccccgttctctgagatggtgatctcgaggt
aggggttgaagcaggcggcgaccttggcggcccaggcggtgaggtagagg
cggaaggtgggcggtacgtagttctgcaccacggaccagaggaagatgat
agtcgccatcgccgacccgaaccctgcccacctctccaccatcat
BLAST
BLAST Search