Query (optional)   in Class  

GrainGenes Sequence Report: CR626930

[ Printable Version ]  [ Submit comment/correction ]

Sequence
CR626930
Subsequence
CR626930_1.cds12399
[ Show all 8 ]
External Databases
Data at GenBank
Data at EMBL
Data at DDBJ
TIGR Gene Index
TC277179
[ Show all 8 ]
DB Remark
Locus Source: Triticum aestivum (bread wheat)
Species
Triticum aestivum
Chromosome
5B
Data Source
genbankRelease 145, Dec 15 2004
genbankDownloaded 2008-2009
Title
Triticum aestivum.
Clone
1793L02
Gene
1793L02_1.1
[ Show all 8 ]
Remark
DB_xref: taxon:4565
[ Show all 42 ]
EMBL Feature
repeat_region26462841Fragmented sequenceLocation: 2646..2841
[ Show all 13 ]
DNA
tcacttgcactgccgcgggtggaacttctcctccgacaggagcgacgtga
cgagccgctggagccgcacggccccgcggccaggctgaaggaagctggtg
ttcccgacgaccgagcaggggtcgctcccgttgtcccctgtccccgcgca
ccagcctccgggggtgggcgcgtccgggccggcgcggcgggacaggagct
ccgcgtcgatccggtccagcacgggctcgtccgcgtggaacttgcgggcg
aagggcgcgtcgctggcgatcatccggtccaggtcgtccatcgtgaggta
gtgcgggtgctgcttcggggggttgtcccacgagatgtagtgcaggtcgt
ggttcaccgtcgtgttcttgaactcctccgcgttgcagaccacggtgtgg
aagtagccctccggggaggagatgaagttggagtagtacatgaggacggt
gcggggcaggttgtcccagccccatatgctgtactcgaccagcgacctgg
acagcgccatccacgctgaacctgcaaacatctcagatttaagagcaaga
ttagttcctcaaaaaggcccaaagtaagaaacttggtcactccataaaag
ctcttgaaacacaagatttctttgctagttggccaaatcatgctaatgtt
ttgcttgcgagttaggaatcttatgccttgaccttcactggaaagtggaa
aggcgggctctgaatcttacagctacctatctagttcagatattaaaaca
tggagggtgcatatcaggccagagaactactacttgagaaacttcgacca
gctgatcttggtgtagactctagaaagaggcagaaagatgaaatttctgg
ggctggtaataagagcatttataacaggtgaagtttactagcacaaaaaa
gtaactgaaactgaaactgaaaataaaggttacattcaataggattggaa
ttattgtcatacaggaaaggcaaatctgaacacagggagtttcctcattt
atgctatgttagttttcagcaaaagaacgaaaaccggcaattaagctaga
aaagcatcacatttattacgcagggttctgcatgacatcttaggaacact
ttgaagatcttattatggtaacaaatcaatttcagttggtggtctggtct
ccacaacttgcatgatcaaacacacatcaatcagcatatatcagttttaa
accctgaacactcagattcactaataataaactcttctagtacagcaaat
tcctttaattggtagagaaattccttccattggcaaaacaagaatttgca
ggagcctagtatgcacagtgaacaatcaaatgcatggaaaatcctagtat
acagcatttctatgctggagctagtatatgtaaataattgggttaccaac
caagaacagtccaatggatcaacaactcgaagcaatataatgtattagta
attaccagtgaatagcttgaaggctgttggcacgctccggcgctgtggta
tccagaacacgtccgccttcttcttcatgtagagccccgggtcgatgatg
accggcttcgccctctgaaacctgcacgcatacagattcacaaaccaaca
agaagcgcattaatttcactatccagccacggtgtgcaagcaatccgggt
agctctaaggaagggagacacctactccttccatccgatgttgctggtgt
ggtcgatgaagttgagatcacgcggcagcttggagaagacatggatcaga
tctgcagcaagcaagctcacaaggtcaaatggtgcgctatggcactgtga
cggacggatcgggagcggtggagcgggcctttaccgtcctgcgtgacgag
cgggtagtcggaggcggagaggttgatgaaccagtcccagtcggacccgc
cggcgccggagtggccccagaggagggccgcggcggcgtgcagggtgctg
gcgaccatggtgggcccgcggtaggtgacgaggttggcccgctcgacgac
gcggacgttgccggcggcggctatgacggggtgcgccgcgaggccggcgg
cgaggccccggcggtcggactcgggcgcctcggcatctaggtgcagcacg
tagaggtgcctggggtggtagagcgcgaggaggacgcggcggagcgcggc
ggcgtccctggcggatccggagatgacgtaggcgatgcgggggagggatc
cggcggcgcgggaggccggcggggttggggcgagcttgtgctccacgaag
agcgccggggagggcgaggaggaggggaagaaggggagcgggacggtggt
gaggaggacgaggaggaagagcgacagcgcggagccgacggccagaggga
gcagccaccggcggtccacggcagcggcgtggacgacgatgggcttcatc
ggcggcggcgggagggggcagccgcagtgccggctttggcagggggaaaa
aggccggattttttggccggtaaagacaggtgaacggcggtaaccactaa
aaccgggtttaataatctactgtgatataaaaccaggtttatacaaacac
ttcaattatcaaatttgagttttttgtgagcatgttctgcttttcccttg
gcttaaccaagattaaaaaaaataaacacaatacaaacatagacacttat
acctacacgcatacgctcatccctataaacgcacacacgcacaccctacc
ccttacgagcacctccgagagactcagtcgacacatcatcttgagattga
taaagtcgccacagacgccttcatagtcgataggggacgtctcctctcac
tgaacgcacatcgccggaggtttgaaatatatctagaaatatgtgagcgc
cagctcaagtttaggacttgaaccctgatgggctggagatatcactgtct
tcctagacatccaatcataggttagttcgcatcaacacttaaccttgaat
ctaacattttgggtataccaccaatttttatttgttgtgatggtagattt
tccttgttaatgtctaaaacatgacttagtatgaattcagtgaaattaac
atatttatctataacatgtgggttgggtttagtccttggtgcacaatgtt
ttcatttctttatcaaatatatacaaaccggttgcatccgtcctaataac
ttgctacaaatgcagttccacaaaacaatgaaaaatcataacaaatgtta
ttcgtgagccacgtggtttcgtatgcatcacaaagcgaaaccacgagtag
aagaggacgacatcttggtgagtcattgtttatcgtgtactactaacaca
taagacacatgttctaacaaattttgggtggattcctatgaaacaaccta
cggaagtccacaagttagcgtccatgaaagagtaaagtataaaacactta
accatatgttttttatagcaatacaataccaaaagcaggacatggaagtg
tcacacatcattactcattgtatgtttccacaaaagagtagatactttat
gaaaaatggcatctatataattaccacacaatggctaatacatgacaaaa
ctaagaaagttagtggaagatggcatctagatgtattacttatcatgttc
tattaccttgtataacacaatctctaccaacatggtctcgatctttcttt
aaagacccgcacaattacaaattaagttccacaaaaaaaacaaagtaaga
agccttggaatagcattacacgtggtctctttcgaggaaaattgcagatt
cagtgcacgaaacatcatctcaacaacttgctaaaattatgtgtgcttgc
aaagtaactttggtcatccaactaaatttgtaagcattcaaaagcaacac
ggaatggtagacatatatcatgtcacatcatccattataaatagtggcct
cacctcaactttcatcttcgccactaccaaaacaacattggcaacatgaa
gaccttcttcctcctagctttccttgctctggtagtgagcactactattg
cgcaatatgcggaagttcccagcccagctatgcaagctcccaccgcggat
gtttttggggaatgggttgcgatagcgcctagtgcgagtggttttgagga
ttgcgaggaagagcatccaaagctagattcttgtagtgattatgttatgg
atcggtgtgtgatgaaggatatgccgctctcttggatctttcctcggact
tgggggaagagaagttgtgaggaggtccgaaaccagtgttgtcagcaatt
gagacaaacgacgccgcgttgccgctgcaaggctatttggacatcaatcc
aaggtgatctaagtggcttcaagggcgttcaacaaggtttgaaagccaga
acggtgcagacggcgaagagccttccctccaagtgcaacattgatccaaa
atactgcaacatccccatcactagcggatattactggtgatgtagcttcc
attagtgaccaataaactatcacataccactgtatgtgaccaataaatgt
gaccatggaataatatatactatagtttcccttatgtatgtatgtgtttc
tcttacaaacatctaattatgcatgtgtctatcaagaaaataatgttaat
tgtgccaatacaaaaggaatgtgtggaagtgcatataggcctctgtgttt
tggtatagatggcggaaaattaaatgggctaattagggcgtacttgtgaa
cagattttagtctcaaccgtgaaggttgtcgagaatcgaagaaccctcaa
aagtgaaaataacacaagaatgtgcctcggtagaggttattttataggtt
ttattcacatttcatgagtttagggatcctccactatttagaggggacgt
ggttggtgaagtgcatgctcaagtgatttcttcactcatatagccttccc
atccaccaaagaaaccaaagcaaaaaagactataaatcatattgttttct
tcttgtcaaagtgcttcgaatttgctgtccggaccgttcggaggtgtgag
catgcatatgctgatctgagcacccgttagaccattcgggcactactccg
accaagtctagggttgcttggtttggcactgaaccaacatcagggatgtg
tccgggtcacttggtctcaatttggaccatccggacctagggccaatgac
caagccgaaccaagggccgattctatggcaagaccgcccaacgccttgtc
tcggttagttctggtgtcgctcgatctactagctagactatccatgctgg
aacatgttacttttgacaataacttatattaacatgttacttttgacaat
aacttatattaacatgttggaactctcaggcctactcaacttcatcgacg
ggctatggtcggcaagcggcggtgagcggatcatcatcttcaccaccaac
cacaaggagaagctggacccggcgctaatccggcggggtaggatggacaa
gcacatcgagatgtcctactgccgcttcgagggcttcaaggtgctcgcca
agaactacctagacgtgaccgagcatgtgttgttcggcgagatccggcag
ctgctcgaagagaccgatatgtcaccggccgacgtggcagagaacctgat
gcccatgtcaaagaagaaaaagaaggacccaaacatgtgcttggcaggcc
tcatcgcggcgctcaaacaggccaagaaagacgcggtgacggttgcggca
gcggcaaaggcgaaggaggaagaggaggcagaagcaaagaaaaccaagga
gaaagaggaacccaaggaagacaaatgaattagccaaccaagacatcaaa
caagtttgattgctcactagtgctcgcttacaacaacaaaaatgatgtat
agtgtttgttcaaataaattatgtatcactcagctggaataaaatggttt
tgctttctcttctcaatggttaattcacacgggaagttaccttcaaaaag
ttgctatatctgatactacaatgcataattctaacattatctgatactac
tattgcaagtacacagtgaacattttcctcattttctacaaaagacagtg
aaaattctggcgtatataacccgcctatatgaacaatacgagaggtaccg
ccgtgatcatgaaggagagtgtgaagacaaggagaaaggcaaatggaggc
acaaaacaaaatatgtatccctcaacaaagaataataatgatgataattc
ctgtgtatgtatggaatagtactacaatacgaaatgccaacctctcactc
ccctgtctcaaacgtactgggcaaagggaatccacaagttttttccatgc
gtgcatggactgtagattcttctcagctctgacagctcctcctcacctgc
tccgacgacggcaaagaagaacacaaatctgttccgatgacgacaaaagg
taaagtcgaacatgctccgacgacgacgacaaaaacgaagacggagacga
agactcaggtcaacctaagtaaatcacccacaactctcccgcattatata
tacacatatgcaggcgcttccagtgcagatcgagctatagcattccaaca
agaaagcctcaagacacaacatcaagaggtccagccatggcgcccatggt
ggagtggttgccatggtttggatcggcggtggcgagcgccatcttcttat
ggtccatggtgcagaaccacgtcccggacaccctccgtctctacctcacc
acccgggcagccaagctcgccgcctgcttcaacccttaccacgagatcac
catctccgagtacggcgccaagcgattccagcgtagcgaatttttcctcg
atgtcgaggcctacctgagcgatgcctgtgctcaccatgcacggaggctc
aaggccgagctcggcaaggacagcaagaacccccaaatcaccgtcgacga
ccacgaggaggtcaccgacgacttctccggaaccacactctggtggtatg
cctccaagcagcaatccaaggccaatgtcatcagcatataccccggccgg
gatgagaagcgattctaccgggttgtaattcttgagttgtaaatccatat
aagtgtgatgattttcattattagagcattgtcctagtgaggaaaggagg
atgaagactatgattcccccacaagtcgggatgagacttcggactttata
aaaataaaagaggccaaaaaagcccatcaaaaagaaaaaaaagaaaaaat
gagaaaagaggaaaaaatttgagaaaggccaaaaagaaaaaaaaagaggc
taaagaaaaaaaagaaaaagaaaaaaaggaaaaaaaatgagagaaaaaga
gagaagggacaatgctactatctctttttccacacttgtgcttcaaaata
gcaccatgatcttcatgatagagagtcttatatggtatcactttcatata
ctagtgggaatttttcattatagaacttgacttgtatatttcaatgatgg
gcttcctcaaagtgccctagatctttgtgagcaagcaagttggatgcaca
cccacttagtttcttttgttgagctttcatatattttatagctatagtgc
atccgttgcatgtcaatccctactcactcacattgatatttattaatgga
catctccatacagcccgttaatatgcctagttgatatgagattatcttct
ccctttttgtcctcacaaccaccataaaccatcatagtgttatgtccatg
gcttgcgctcatatattgcgtaagagttgaaaaagctgaagcgcgttaaa
aagtatgaaccaattgctcggctcgtcatcgaggttgtacatgatgggag
tattttgtgtaatgaaaatgaagcatggcctaactatatgattttatagg
gataagctttctttggctatgctattttgatattacatgattatttgtta
gtatgctttgaagcattattatttttatgttttataagcttttattctaa
atctaatggatatattttagccggaaaaatacttaatcccgtaaaatggc
agagttttacgagccgtcgagcttttgtacaatctgctagggatgctctg
atccatcctttttggtaaaattgtagctagcagaagatcacctatataca
tatgtttcttggtccacagtgagtagccaataaatagagtgctgaaataa
taatatatgaaagtgctgaaataataatatatgaaaaagattatcctata
tatgtatgtttcttggtacaaatacgcagccaaactcacaagagaacgtg
cgcgtgtatctgaataccacatgtccacatgacaaaagcaaaaccatagc
tagatgacgacaacattcagatgcattatttacaatgtaaaagaaaatgc
ccaacaacttggctaggatccttgttaagaattcattttttgataatcat
gctcaaattaaaaaaaaacactgcttggcttgtgcctcccgtcggtgtta
gccgtccatgcctggtcctatgtggccttagggccatcgagacacggtgg
atccaggtcttcaccaacgtgaggacttcgttttctaatatctttttaag
ttttgttagtgtttgtgttctactcagaaagacgaggtgacgatggtcct
ctgcagatggaataagtttctttcctccttgtccccgtttcggcggcgct
tcttgcattgttggagggcgtgtgaagatttatctccggcgaatccagga
ttcggttggcgattgtctacggtggatccacgtgaattcgttctttgttc
gtcaatggtcgtgtgtctacaggttgaatccttctgatctacacttcttt
tcttcgacagaggttgctgttctggtgctctggtcttgtagggccttagc
acgacaacttaccgactatctactacaataaggtttgtccggcttggtga
gggaggggagatgacgacggcgtgccttcggcttgcttcagtagtcgtcc
taggcggtgtacgaacctcgatgtaaattttagttctagtgttatttgta
ctaccttaacttaacagttgatgaatagattgaatttgttttaatttctt
ttaaaaaaacagtcatcctctctcctagaaaaacaacattctccatttct
cacatttgcgatggtttcttctcagcgggcccacgctgtcagtgacacac
ggcggctagtgggtgtcacgtagcttacgtggcagcataaagggaggtcc
ttgaagccaccgagctaaaaaagacaattcttttcttcctcttctgttcc
ggcaggggcggcggggatggcgatggcgtcgcgcgcgcggacgcggtggt
cggcgctggcggcgagcacgctgatccagtgcttcgcgggcggcagctac
tgcttcggcgtctactcgccggcgctcaaggcgtcgcagggctacgacca
gtccgcgctcgacgccgtcgccttcttcaaggacgtcggcgctaacgtcg
gggtcctctccggcctcctcgccgcgtgggctccctctgggggccggagg
cgaccctggctcgtcctcctcaccggcgccgcgctctgcgccgccgggta
cctccccatgtggctcgccgtcgccggggtcgtccccgccccgctcccgc
tcgtctgcctctacatgctgctcgccgcgcaggcgcagaccttcatgaac
acggccgatgtcgtcaccgccgtagagaacttccccgaccgccgcggcac
cgtcatcggcatcatgaaggtacgatccccttactctgttttcttgtaca
gtagtattcagtctctgctctgttgctctgcatcagtaatttgctctgtg
agttccaagaaaacaatccaaaaacagcctttgtctgctccaatctacaa
accgaaaacagtatttgttttgttccatttttatgtggagaaatctgttt
tggtggcatactataccacaccagtacagagatatatgctgaaagtgatt
ttgatgcaacacagccttacaggtaaacagttctagaataatgtgatttg
ttaagacttgtagtagttcatcatccagcacaaccattctaggaattcat
gcttgctcccagggaggcagcatcgctggttatagaaaagtacaattgtg
tagctcattataatgttttctggtccagagacatcagagaggcaataatg
cagtgttcattcgctggtggagtatcatttttgtcttaattgcccgaact
ttcagcgttgttgtcttgagttttcgcctagcgctgtattcgtgatgatg
tcaacttgtgtggatcgtacatagcacacacttaatttgctcaataatcc
cagcctgcactctgtttctcaaaaacaaatcaaactacttagtatttgtc
ttcttacacaacaagtatagatatgtcctactccttccaatgacatcgat
tcatctgtttaatttccaaacaggggtttctaggcttgagtggggcgata
ctggtccaagtacagcggactctccgtattgatcccggcagtttcatact
tatgctggcaatactacccacagccatcgcgttgctgctcatgtactttg
tcgacgtccacagcgctcatgagcggtacaacaagaagttcctcgatgct
ttctctctcatggccgttactgttgctgggttcctgatggttgtcataat
ctgcgaccaagtattcgtgataagttcagccgggcagagcgtttgctttg
ggatactccttctattgatcctgtctcccgcagctattgttgtaagggct
cagaggacggaaccgaagcagcaagaagaaccaacgccggaagaacaaac
tggtttacttcttcatgaggagactgcgcagcaggattcggagaacgcca
gctctagcatggcgctcgtgggatctaacagtcaggacatgtcgtcggac
aaagcagagaacctgaacgtggtgcaggccatgtgcaaacttgacttctg
gctgctcttcgttgcgatggcctgcgggatggggtcggggctggccaccg
tgaacaacatcagccagatcgggggctcccttggctacacgagcagggag
accagcactctggtgtcgctatggagcatctggaacttctcagggaggtt
cggcgcaggctacgtctctgatcacttcctccggtcgcgaggagtcggca
ggcctttcttcatagccgcgacgcttctggtcatgggcgtaggccatgcc
atcatctcctccggtttccacgcgtcgctctacgtcggctccgtccttgt
aggactgtgctacgggtctcagtgggctttgatgccgagcataacttcag
agatcttcgggctaaaccatttcggcaccatattcaacacggtggccgtc
gcgagccctgttggctcttacatcctctcggtgtgcgtggtcgggttcat
ctatgacaaggagtcaccgcaaggtgagcttgcctgcgccggtaagcact
gctttgcgctctccttcatgatcatggcatgtgtctgcgtcttcgggtct
gctgttgcttttgtattgtttgtcagaacaaggaagttttataggcgggt
tatatacgcccgactgctctcttttgtagataaatgaagaaatgcatata
tgcaaacgattctcagtttcccttgtgttcttgcagcaatatcacgttag
catttggtattgtagcactctctctatatagtaacaatacaatggtcact
tcctgtgtgagtaagcaaatgagaaaataaaccaatattattttatttca
gttgattgacacatctttatcaaaaaaaaaaaagaagaagaagctgagtg
atatatatttgtgttcttacatcaataccatgttatcatttggtattgta
acataatatgtagcaacattataatgcccatttcctggagaagagaaagc
aatgttatttatttatttaattattttattgcagttgagtgatatatatt
ttatttgaacaaacactgcatccttttgtgtttgtaagggaacactcaac
tcctgtaacttcacttgtcaccttgcttgatgaggtctccattggcttcc
tccaatgctttgtccttcccttcgtctttcttggcctccccctccttttt
atccttggctttcttcgcttcagcctccttggcctcctcttcctccttag
cctttgccgctgccgcgtcttccttggcctgcttgagcaccttgatgagg
cctgccaagcacacatcggggtccctcttcttcttctttgacatgggcat
caggttctccgccacatcagcaggcgacatgtcgatctcctcgagcagct
gctggatctcgccgaacagctcgtgctcgacgacgtccatgtagttcttg
gcgagcaccttgaatccctcgaaacgacagtaggacatctcgatgtgctt
gtccatcctgccccgccggatcagtgcagggtccagcttctccttgtgat
tggtcgtgaagatgataatctgctcacctccgcaggccgaccacagcccg
tcgatgaagttgagcaggccagagagcgtcactttggtgtcatcgtcctt
ctctggctccattggtagcttgggtctgtcatcgtcatcagagtccttat
cgccagaagccttcttgtccttgtggccttttccagcgaggtctgcggag
cagtcaatgtcttctatgacgatgatggatttgcctgttgtctcgatgaa
gagcttccgcagctcggtgttgttcttgacggccgtgagttcgaggtcgt
agacgtcgtagtcgaggaaattggccatggcggcaatcatagtggacttg
cccgtgccaggaggaccgtataggaggtatccacgcttccatgccttgcc
gacttttgcataatactccttgccctcctagaaggccatgaggtcgttga
tgatggcctccttctgatcggggtccatggcaagcgtgtcgaacgtcgct
gggtgctcgaatgcgatgtggctccaaacgctcttggcccggtgagggtt
ccagctaccgccggcgttgttggtgaagaggcggcgttggcggttgttga
tggtgacggcacggcccttgctgaggacaaatggtaggtaggagccaaca
acgagttcacggtgtcagcctatgaaagacgacccggtagaatcgcttct
catcccggcctgggtatatgctgatgacgttagccttggattgctgcttg
gaggcataccaccagagtgtggttccggagaagtcgtcggtgacctcctc
gtggtcgtcgacggtgatttgggggttcttgctgtccttgccgagctcgg
ccttgagcctccgtgcatggtgagcacaggcatcgctcaggtaggcctcg
acagcgaggaaaaattcgctacgctggaatcgcttggcgccgtactcgga
gatggtgatctcgtggtaagggttgaagcaggcggtgagcttggctgccc
gggtggtgaggtagagacggagggtgtccgggacgtggttctgcaccatg
gaccataagaagatggcgctcgccaccgccgatccaaaccatggcaacca
ctccaccatgggcgccatggctggacctcttgatgttgtgtcttgaggct
ttcttgttggaatgctatagctcgatctgcactggaagcgcctgcatatg
tgtatatataatgcgggagagttgtgggtgatttacttaggttgacctga
gtcttcgtctccgtcttcgtttttgtcgtcgtcgtcggagcatgttcgac
tttaccttttgtcgtcatcggaacagatttgtgttcttctttgccgtcgt
cggagcaggtgaggaggagctgtcagagctgagaagaatctacagtccat
gcacgcatggaaaaaacttgtggattccctttgcccagtacgtttgagac
aggggagtgagaggttggcatttcgtattgtagtactattccatacatac
acaggaattatcatcattattattctttgttgagggatacatattttgtt
ttgtgcctccatttgcctttctctttggcttcacactctccttcatgatc
atgttagaatatacgccagaatgctgtctttgtaccgctcgtattattcg
ttgggacgagcaagttctgtaggcaggttatatacgccagaatgctgtct
tttgtagagaaatgaggaaaatgttcgctgtgtacttgcaacagtatcat
attagaattatgcattgtggtgtcagatatagcaactttttgaaggtaac
ttcccgtgtgaattaaccattgagaagagaaagcaaaaccattttattcc
agctgagtgatacataatttatttgaacaaacactatacatcctttttgt
tgttgtaatcgagcactagtgaacaagcaaacttgtttgatgtcttggtt
ggctacctggcttcctgtcatgttttttacctttcatttgtcttccttgg
gttcctctttctccttggatttctttgcttctgcctcctcttcctccttg
gcctttgccgctgccgcagccgtggcagcatctttcttcgcctgtttgag
cgcggcgataaggcttgccaagctcatgttggggtccttctttttcttct
ttgacatgggcatcaggttctctgccacatcggccggtgacatgtcggtc
tcttcgagaagctgctggatctcgccgaacaacacatgctcgacgatgtc
taggtagttcttggcgagaaccttgaagccctcgaagcggcagtaggaca
tctcgatgtgcttgtccatcctaccccgccggattagcgccgggtccagc
ttctccttgtggttggtggtgaagatgatgatctgctcaccgccgcttgc
tgaccatagcccgtcgatgaagttgagtaggcctgagagcgtcaccttgc
tttcatcgtccttctgtggctccgtcgggtccgcttcatattcattgtca
gagtccttgttacttgaggccttcttgcccttgcggcgcttaccagtgag
gtcaatggagcaatcgatgtcctcgatgacgatgatggacttgcttgtca
tctcgatgaagagctttctcaactcggttttgttcttgaccgacgtaagc
tcgagtcatatacgtcgtaatcaaggaaattggccatggcggcgatcatg
gtggacttaccagtgccgggtgggccgtacaataggtaccccgcttccat
gccttgccgacctttgtgtagtactccttgccctccttgaatgcgatgag
gtcgtcgatgatggcctccttctggttggtatccatggcgagcgtgtcga
acgtggccgggtgcataaacttaacatagtcccagacgctattgcgaagg
tagcgcttccgtttaccgccacagttggtgacgaaagcatataatagaac
acctgcactcaggtcctccctatctagccatccattctgcgcatcgtgat
tcatgtaaacatatttcttttttttgtttctctcacataaaacatgtttt
gaagttcaaacgtttgtagcatggcaaagttttctatctagaatctagga
taaatctttcagatttttttatcaaatataaatatacaaattatgatttt
ctagataaaaaaatcatattttgtatatttatgtttgacaaaaaattctg
aaagatttatcctagattctaaaaagaaagttttgccacgctgcaaaggt
ttgagttcaagacatgttctacgtgagagaaacaaaaaagagaaaatttc
atatagaaagttagttgtgttgcacggatcttaaagcaatattggacagc
caggatagctgggcccgggtgcagatgttcaaaaaaatccacgtcccagt
ttgtgaagaggcggcgctggcggttcttgacgatgacgtttatgccgtgc
tagtgatgggcatgtttatgccaaattcgttggttcttactatgagtaca
ttgaatggtctatttgggttcctaagacccttgttgctaacgtcaaatga
cccattcaaaaatgggtacctaaatccaagcattgatctcttgtaggagt
ttttttttccggtggagtgtcattgttgcttgatagtggagtaacaaatc
atatgaccgggagtaaggacttggtggtggatgtgcaccaattccatcta
tgcccacccatctttaatttgctgatgcctcaacttctaaagtattggga
cttggcaaggtagtcatctctcaagatttaactattgggaagctcatact
tgttgagtctcttgcatacaatttactttccattcgtcaacttgcaatta
tgggctttgcaacattctttgatcttgacaccgtggcccttttgtggagc
aatactcttaaagtagcctttgttgggcatgtcgagaacggtctctatgt
ggtgaacttttcggaacgacccactaccactaagaccgcgacttgcctaa
tggctaaagttgatgtgggttggctttggcatcaccgactagcccatgtc
aatatgagatctttgtaaagtcttctcaaaggtgatcacgtgcgtggact
aacaaatgtgagttttgccaaagaccgtgcttgaagtgcttgtatcgaag
gaaagcttcataaaacggctccagcggacccgaggaagatgatgctcgcc
gcccaaccccgcccacctctccaccatcgctgccatggccggcaagctct
cttcttcttgatgccacttgttcgtgtgtgtatataatgctggtgattta
cttaagttgacttgagcgcgaccggtggtcgttgttgccgtcggagcagg
tgaagagtagctatcagggctgggtaagttcatgcaacgcatggaaaaga
tgcagaacttagttgcttaatcaattaattactaggtggaaaggcaaatt
caaatttgggttgcttaatcaattaactggaaggagcagggtaagttccg
attgctagttgcatgctgtgtcactgtcatgcgtagtgacgatattgtgt
tggtgaaatggtagagaagcttcttatgccatgtttaggtttaattcccg
atagaaaaagtcgttagcattttggtgtaggtaaagcggatgggtcttgt
tagcattttgtatagttttaccgaaaataatactatatatatatatatat
atatatatatatatatatatatatatagtattaatattcatcatccagga
tgcacaataatttattcttcacccgaggtaatcttatgatcgctttctaa
ataaattatgtttagaatataaatagttgcatgcatattggtttaatata
taaactttggtataaaaaacaaaagtataggttataagaccagaaaaatc
acattttatgtacgttttacactatgtttttacattcgttattttacgta
acataaaatattttttgaggcgagtatatattttcttactttttttatgt
atgaaataaggcaaaatttacgaaatgtaaaaatacgatgcattgaagtc
agaatagaaaatgggtgaagaataactatttctcacccaggggaacgaat
agcgcttatatatataagggggcagatattacaaatgagagatacaacac
ataatatttcggttgagagtttatattttctgtgaccaaacactgcattt
tctttttgtactagtgaacaagctcattcttttttcctttgcttcctttc
ttggtatcacttcacttgtcaccttctttgatgtctccattggctttctc
cggtgctttgtccttccctttgttttcctcctttgctttcttcacctccg
tctcctctttctccttaactttctttgcttcagcctccttggcctcttct
tccgccttcgccttggccgccgctgctgccgcgccttccttggcctgctt
gagcgcctcgacgaggcctgagaaacacaaatcagggtccctctttttct
tcttcgacattggcatcagattctctgcaacatcggcgggcgacatgtcg
gtctcctcgagtagccgctgaatttccccaaacaggtcatgctcaatgac
atctaggtagttcttggctagaaccttgaagccctcgaagcggcagtatg
acatctcgatatgcttgtccatccttcctcgacggatcagcgccggatcg
agcttctccttgtggttggtggtgaagatgatgatccgctcacccccgca
agcagaccatagcccgtcgatgaagttgaggaggcccgagagcgtcacct
tggtggcgtcgtccttctctggatccatcggtagcttgggtttgtcatca
ctgtcggagtccttgtctccagaggccttcttgtccttgcggcgttttcc
ggtgaggtcaatcgagcagtcgatgtcctctatgacgatgatggacttgc
ccgtggtctcgatgaagagcttccgcagctcggtgttgttcttgacagca
gtgagctcgagatcgtagacatcgtagtcaaggaagttggccatggcggc
gatcatggtggacttgccggtgccgggcggtccataaaggaggtacccgc
gcttccacgccttgccgacctttgcatagtagtccttgctctcctggaat
gccatgaggtcgtcaacgatggcctccttctcatcggggtgcatggcgag
cgtgtcgaaggtggcggggtgctcgaaggggacgtggctccagacgctct
tgctgcggtaggggttccagttgcggctggcgttgttggtgaagagacgg
cgctggcggttcttgacggtgacggcgcgaccctcgccgagcacgaaggg
caggtaggagtcgacgacaaggtcgcggtggcgcctgtggaagatgacct
tgtagaagcgccgctcgtcctcgccggggtagaagctgatgacttgggcc
ttggactgccgcttggaggcgtaccaccagatggtcgtgccggagaagtc
gtcggtgacctcgtcgtggtcgtcgacggtgacctggaggttcttgctgt
ccttgccgagctcggccttgagcttccgtgcgcgccgggcgcatgcctcg
ctgaggtaggcctcaacggcgaggaagaagtcgctacgctggaagcgctc
ggcgccatactcggagatggtgatttggaggtaggggttgaagcaggcgg
cgacctttgcggcccaggcggtgaggtagaggcggaaggtgggaggtacg
tagttctgcaccacggaccagagaaagatgacggtcgccatagccgaccc
gaaccccgcccacctctctaccat
BLAST
BLAST Search