Query (optional)   in Class  

GrainGenes Sequence Report: CV066699

[ Printable Version ]  [ Submit comment/correction ]

Sequence
CV066699
External Databases
Data at GenBank
Data at EMBL
Data at DDBJ
TIGR Gene Index
TC327004
NCBI UniGene
Ta.10147
DB Remark
Locus Source: Triticum aestivum (bread wheat)
UniGene title 'Transcribed locus'
Keyword
EST
Species
Triticum aestivum
Cultivar
Hartog
Clone Library
Wheat EST endosperm library
Tissue
endosperm
Developmental Stage
developing endosperm tissue 6, 8, 10 dpa (days post anthesis)
Data Source
genbankRelease 144, Oct 15 2004
genbankUpdated Nov 2006
Title
WNEL7b3 Wheat EST endosperm library Triticum aestivum cDNA clone WNEL7b3 5' similar to Unknown Function, mRNA sequence.
Strain
lab_host DH10B (Life Technology)
Clone
WNEL7b3
Probe
MAG1873
Remark
DB_xref: taxon:4565
Feature: source: mol_type = 'mRNA';
Feature: source: mol_type = 'mRNA'
Locus Comment: Contact: Bill Taylor; Commonwealth Scientific and Industrial Research Organisation; Division of Plant Industry.; CSIRO Plant Industry, GPO Box 1600, Canberra, ACT 2601, Australia; Tel: 61 2 6246 5223; Fax: 61 2 6246 5000; Email: Bill.Taylor@csiro.au; Seq primer: M13 reverse primer; High quality sequence stop: 429.
Note: Vector: _ZipLox; Site_1: Sal I; Site_2: Not I; mRNA was prepared from endosperm tissues of the wheat cultivar Hartog. cDNA was synthesised from pooled 6, 8, and 10 dpa endosperm using Not I-oligo(dT)18 primer/adapter (Pharmacia Biotech), and then ligated to the Sal I-Not I site of _ZipLox vector (Life Technology) after adding a Sal I-Xho I adapter (Stratagene). Constructed by Shahjahan Ali and Bill Taylor.
DNA
tgataaaaaaaaggtgatgcgagactgttggcatcacatcgaaaagaaac
ttggtgaccagtacccgccactccatagcgcatgttgcaatacaataagg
gatgcaaaagacatccactgcgtctgtgatcggttcaccgctcacgaact
gactttgctcagtctagccaagtttgccatggctacacatgtatgcggca
atgggttgcacacagacactcactgtgcaggttatcgtgttccggaaata
aagctaccacctccacccgcgtcaagtacctaggccttaagtgtaagacc
attttcataatggagaaataattaaataaagcaaagaatgatgtcagatg
aatggtatttgctgtgtacttgaccttttctgtgtgtattgaaaaaaatt
gggcataaaaaaaaaaaaaaaaaattcct
BLAST
BLAST Search