Query (optional)   in Class  

GrainGenes Sequence Report: CV758690

[ Printable Version ]  [ Submit comment/correction ]

Sequence
CV758690
External Databases
Data at GenBank
Data at EMBL
Data at DDBJ
TIGR Gene Index
TC306463
NCBI UniGene
Ta.54027
DB Remark
Locus Source: Triticum aestivum (bread wheat)
UniGene title 'Transcribed locus, moderately similar to NP_001053208.1 Os04g0497700 [Oryza sativa (japonica cultivar-group)]'
Keyword
EST
Species
Triticum aestivum
Clone Library
Triticum aestivum FGAS: Library 2 Gate 3
Data Source
genbankRelease 145, Dec 15 2004
genbankUpdated Nov 2006
Title
FGAS052966 Triticum aestivum FGAS: Library 2 Gate 3 Triticum aestivum cDNA, mRNA sequence.
Probe
MAG1889
Remark
DB_xref: taxon:4565
Feature: source: mol_type = 'mRNA';
Feature: source: mol_type = 'mRNA'
Locus Comment: Contact: Wm L Crosby; Bioinformatics; University of Saskatchewan, Department of Computer Science; 1C101 Engineering Building, 57 Campus Drive, Saskatoon,; Saskatchewan, S7N 5A9, Canada; Tel: 306 966 1769; Fax: 306 966 2033; Email: fgas_ests@cs.usask.ca; This sequence is the direct result of the Base calling software; Phred (default parameters). It is the raw base calls. To aid in the; identification of the high quality insert the software Lucy; (default parameters) has been run on this sequence. Lucy identified; the region [99,583].; Plate: WEF001 row: E column: 11.
Note: Organ: Crown and leaf; Vector: pCMV.SPORT6; Aerial parts (crown and leaf) of wheat cultivar Norstar from control and long exposure times to low temperature. 4 mRNA populations were combined before constructing the library; 7 days non-acclimated plants and 1, 23, and 53 days cold-acclimated at 4C. Non-acclimated and cold-acclimated plants were grown in vermiculite This is the only library that was done according to the Invitrogen manual, and therefore, a percentage of clones will not have the 3 prime end because of NotI digestion within the cDNA.
DNA
acgctatgaccattaggcctatttaggtgacacttcgaacagaggtgtac
aaaaaagcaggtctgctaccggtccggaattcccgggatatcgtcgaccc
acgcgtccgggccgagagaaaaagcttggctgagaatcgcctggtcactg
cagccaatcacggtggtggcgctggtgctagctgggctcgtcggactgtg
agcgagcagtgagcgcgtacgtgccatggagggggaggagaagccggtgg
tgggcggggcctactggggcgtgggcgcgagggcctgcgactcgtgcgcc
accgaggcggccaggctcttctgccgcgccgacgccgcgttcctctgcgc
cggctgcgacgcgcgcgcgcacggcgccgggtcgcgccacgcccgggtct
ggctctgcgaggtctgcgagcacgcgcccgcggccgtcacgtgcaaggcc
gacgccgccgtgctctgcgcctcctgcgacgccgacatccacgccgccaa
cccgctcgcgcgccgacacgagcgcgtccccgtcgcgcccttcttcggca
cggccgccgacgcgcacaagcccttcgtgtcgtcgggagcccaggccgct
gcccgagacgacgggagcaacgacgccgaaggggcgtcgtggctgctccc
caagcccgatcacaaagattggtgctacccgccgaagtcttctttcgcgg
attccgaaccattaccctcgacctcgacttccccgcgggtcaatgggcac
aacttcaagggccatcagcggtgcagcttcaacggcccagccccgaaaat
cgaacctccaacggcgggaaccaaagaggttttcaacttccaaccccctc
catggaacccacaccggtatccgt
BLAST
BLAST Search