Query (optional)   in Class  

GrainGenes Sequence Report: DQ013357

[ Printable Version ]  [ Submit comment/correction ]

Sequence
DQ013357
Subsequence
DQ013357_1.cds283077
External Databases
Data at GenBank
Data at EMBL
Data at DDBJ
TIGR Gene Index
TC277109
DB Remark
Locus Source: Triticum aestivum (bread wheat)
Species
Triticum aestivum
Cultivar
Ning 982105; dwarf wheat
Developmental Stage
etiolated seedling
Data Source
genbankRelease 145, Dec 15 2004
Title
Triticum aestivum wall-associated kinase 2 (WAK2) gene, complete cds.
Gene Product
wall-associated kinase 2
Remark
DB_xref: taxon:4565
Feature: source: mol_type = 'genomic DNA'
Gene: WAK2
EMBL Feature
feature_gene283077Location: <28..>3077
DNA
tagcaagtgagcagaagatacaccacgatggctccaccggcgaaactgac
ccagtatacccagctgatcctactcctccttgcagcagcagtagctagtg
atcacttgaccctgcaccaggctgcggctgccgccgatgaactacaaggc
cgaccgcagcaggggctggggcgtccgggttgccgggacaagtgcggcga
catgagcatcccgttacccttcggcatggacaagcccggctgcttcctac
ccggcttcgaggtcacctgcaacacctcctctactccgcctcgcgccttc
ctcgcctacaaccacagccagccaccataccagcatatttaccagtatgc
attcaacactgagggcggggctacaagccaaatagaggggcgtcaggcgg
tcgagctgttcgacatatcactcgagacgagcgaggtacgtgtgtacagc
ggcgccaattcccggtgcttcacaaacgaatccgcgggtttagacaaggg
tgaatacatggagttggacagggaggggccgttcctcctgtcgtcgacgc
gcgacgatctcgtcggcgtcggctggaacgccgagccctccatgacatac
acggtcaagacctcgccggaccctctctcctgcacctcaaacgatccctt
catgtcggccacagatggggagtgctcgggtctgggctgctgtcagattg
ccctgcggccgcagatctcgactctccctgtcattagtaccggggtgatc
ttgaagaattacatcaatattcgctgggaaaccaatccatgctcctacgg
catggtggtggagaggtcatggtacaacttcacggaggaggacttgtacg
gccacgaggtgctatctacgaaactcagcaggggcttcccgttggtgctt
gatttcgccatcagggacggctcgtgtgagcgcgacggctgcctcagcgg
caacagttcttgtgccatagcagccggaggctatgtctgcaagtgccggg
agcattacaatggcaacccctacatcaccgttggatgccaaggtatctaa
ttccacctcaaacttcagtatctaattccaccaattagtactagctactt
cagtatctaattccgtctgctagtttgtcattgtatttttaattcaactc
tcaaactttcatatcttcatctttttcccagacatcgatgaatgtcaact
ccgagaacagagtcccgagttccgtgatttatatccgtgtgacgggatct
gcacgaacatacccggaggatatgactgccgatgcaaacgcgggatgaaa
ggcgacgccaaaaagggaacctgcgccgaaatttttcccctgtcagcaaa
gatcatcgttggtacgtgctgatctaccacaccagattgactgggtagtt
aaatacacacatattttattcttagataccatgtttagaagaagaaaagt
gatgtgtttgacaagattccgttgttcaatggtttaaaatattataatct
ggtgacgtgcatgttgactgaaaataaaccatactagttaattacttgat
tcagagagtgaattacaagcagaggccgggcataatatatcgcgtattag
aaaactcgagcttgacaattagtaaaattattagcaaatagacgagtcat
ttgggttgctcttattgtatcttaattccatcacttaagtcctgatatat
agtacgtgtcaatacacagattacttacagttgttttttgataaagcata
agcttgattaggttttttttatcaaaagggaggaaaactgccggcttttg
tatcggtcggctgatgcacacaaccatataagcttgattagttacttcct
agtattgtacactttgtttagttttagttgatacttgatatgattattat
gctatttaagcgtttagatagaaatagcatatgtaaagttaacacttatt
gtttagttaggggtgctgtgttcgattgtcaaaaagagattcacgttggt
ttaactgaagcttcaataccttgcttattcgtaggtcttgctggattgat
tgttgtctttgtcatcattgttatggccaagcaacacctaaaacttaaga
agttctatgcacaaaatggtggtccaatacttaatggtgtcaagaatata
cggatatacacgaggaaacagctgaaacaagtaacaaacaactatgagtg
tgtcattggacagggccacttcggtaaggtttataagggcactctgaaag
ataaacaacaagtggctgtgaagaagtccatcaaagttgacaaggacatg
aagaaggaattcaccgatgaggttataatccaatccgagatgaggcacaa
aaacattgtcaggctcctaggttgttgcctagagttcgatgttcccgtgt
tggtgtatgagtttgtggcgaaagggagtttgtatgatgtcctcctcaaa
aggaaggatagcattccagtgaacaagcgccttgcaattgctattgggtc
agctgaaggcctaacatatatgcactcggctggggagagtacgatacgtc
acggtgatgttaaatctgcaaacattcttcttgatgaacattccacccca
aaagtttcagactttggtacctcgaagttgctcgcaaaaggaaaagacga
ggagactgatcgtgttattggggacatgagttacatagatccaatatata
tggagaagggggtcattacacaaaagagtgatgtctacagttttggaatt
gttctcatagagctcatcacaagaagacctgcaacatatgacgtcaagag
gagctatgttgcaaactttgttcaatcttgtgcagaaaaaagagtaagga
actttattgataacgatattacaagtgaggttgatattgctatgttggaa
atggttagtggggttgctgcagattgtctaaaacctaatccagaagaatg
gcatgatatgaaacaagtagaacaccggctcctcaaaattattggacaac
ccgtatatcatggtcagaagggaaactcccagttagatcttcgtcctgca
cctgatcatgttgctttgcttagctaacatgttgcattttcatttggtta
tgtaatgtggtttcttt
BLAST
BLAST Search