Query (optional)   in Class  

GrainGenes Sequence Report: D_F5XZDLF02JM8I4_253

[ Printable Version ]  [ Submit comment/correction ]

Sequence
D_F5XZDLF02JM8I4_253
Contig
1AL_1061222
Species
Triticum aestivum
Probe
D_F5XZDLF02JM8I4_253
DNA
AAGACGCGCGAGGAGCTCCTGGGTATTGAATTCATGCTCCAGTCAACTCA
TCCAAAAGTCTAAACTGATGGAGGAAGGCAGGCAATATATTTCAACACTG
GGGTTCCTCCCGCTCGGCGTCGC
BLAST
BLAST Search