Query (optional)   in Class  

GrainGenes Sequence Report: D_GB5Y7FA02I2TC7_215

[Submit comment/correction]

Sequence
D_GB5Y7FA02I2TC7_215
Contig
5DS_2739401
Probe
D_GB5Y7FA02I2TC7_215
DNA Homology
5DS_2739401Best IWGSC match4590URGI_BestIWGSC_N
BLAST, e-value
05DS_2739401Best IWGSC match
DNA
tttcatccgtcttcctgtccggatgcctgggaaccaatccgaatatataa
gcccatggaagatccgggatgtcatctgtagtgacgggtcgctcaagttc
gttgaagtcgaagatttgtatacacRggaggattgtgctcctgctgctcc
atctgatcctgacatattctatgatggtctggattcctacacggacgatt
tggccgatagtttgcccactcgaccgacctggactggttggagggccgtc

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.