Query (optional)   in Class  

GrainGenes Sequence Report: D_GCE8AKX01BOGN5_399

[Submit comment/correction]

Sequence
D_GCE8AKX01BOGN5_399
Contig
4DL_14423664
Probe
D_GCE8AKX01BOGN5_399
DNA Homology
4DL_14423664Best IWGSC match3310URGI_BestIWGSC_N
BLAST, e-value
04DL_14423664Best IWGSC match
DNA
ctatttctactacctacccccaaagtttgggtatctgtcaagttgctgtt
caaagcRgacaatatttttgtctattagatcatccgtttagcataacaat
cgcaggtctaggaatgaccgtggtaattttttagtgaaaatgaccgtggt
aagtgcttgcactgtttaatgcattgtagtt

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.