Query (optional)   in Class  

GrainGenes Sequence Report: D_contig00440_482

[Submit comment/correction]

Sequence
D_contig00440_482
Contig
3AS_3296705
Species
Triticum aestivum
Probe
D_contig00440_482
DNA
GCGGGTTATTCATCCATTGGTCAGCCGATAAAAAGCTGCACCCCTTCGAC
AACGGCCTCCGCGACGAAGGCCATCATGAAGAACTCAACGTTCTCCTTGG
GAAGTGCCCCCTCGCCGGCCAAA
BLAST
BLAST Search

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.