Query (optional)   in Class  

GrainGenes Sequence Report: D_contig02411_248

[Submit comment/correction]

Sequence
D_contig02411_248
Contig
2DS_5328231
Probe
D_contig02411_248
DNA Homology
2DS_5328231Best IWGSC match4420URGI_BestIWGSC_N
BLAST, e-value
02DS_5328231Best IWGSC match
DNA
tatttcatcatcccttacacgatagcgaccgccttctggcagcagcagag
tgaccgtgtaacccgggttcctccatatttggtataggttgccctggtag
aaggccaagttcttcgcgctactatRgcccgacacaatgtcatacgaccg
gacaaagctagtggcgggatcgaacggaaggttggctgaggacaggaagg
gatcgagcacggtgagtggtgcatttcggtctcgtccaatcgcttactcg

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.