Query (optional)   in Class  

GrainGenes Sequence Report: D_contig06841_228

[Submit comment/correction]

Sequence
D_contig06841_228
Contig
5DL_4510562
Probe
D_contig06841_228
DNA Homology
5DL_4510562Best IWGSC match4590URGI_BestIWGSC_N
BLAST, e-value
05DL_4510562Best IWGSC match
DNA
gatgatgatgctccatcagttgaatatcgttcaaccagtttatctggcga
aaggaaaacagatgaacccatccatgtacattcagtaccactagtttcag
aacttaactgtaactataacaccctMggtaagctgtctctttacattttt
atcttatgctcataccctacttatttgttggtgtagtattactatagaag
ttattttttctaacacttgcaatttctatcagctgagttttttttttaca

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.