Query (optional)   in Class  

GrainGenes Sequence Report: D_contig37179_75

[Submit comment/correction]

Sequence
D_contig37179_75
Contig
1DS_1893292
Species
Triticum aestivum
Probe
D_contig37179_75
DNA Homology
1DS_1893292Best IWGSC match3390URGI_BestIWGSC_N
BLAST, e-value
01DS_1893292Best IWGSC match
DNA
tggggtcccacacgttgcctgagaccagacgccagcgtttacacgtgggg
cgtcgcgcctggtcgtgccggcgctgagcggctgatgctgttcggagcga
agcgcgaaggcgaggaagcaaacagRgtcgttgtccaagcatgggaggtg
gatggcgacgctctggatctgtcccccggcgcggcgcatgacgcaatgcc

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.